Description :
From Genome Similarity Track
Location :
contig_38:346182- 354896
Transcript NameFunction/comments
g8772.t1POM57413.1 Ribonucleoside-diphosphate reductase small chain [Phytophthora palmivora var. palmivora
g8773.t1POM57413.1 Ribonucleoside-diphosphate reductase small chain [Phytophthora palmivora var. palmivora
g8774.t1XP_008911517.1 hypothetical protein PPTG_16021 [Phytophthora parasitica INRA-310
g8775.t1hypothetical protein
g8776.t1hypothetical protein

Sequence
8714 bases(100 bases per row)
GAGTTCGTGGCCGACCGCCTGCTGTACTCACTGGGTGCATCCAAGATCTACAACGTGAAGAACCCGTTCGACTGGATGGATATGATCTCGCTGCAGGGCA
AGACCAACTTCTTCGAGAAGCGCGTGGGCGAGTACTCCAAGGCTGGTGTGGGTGTCGCGGCCGAGGACCAGGTGTTCACTCTGGACGCAGACTTTTAAGT
CCGTGTCTAAGATGAAAGTGTGGGTCGTCCATGTCTTCGCCCGCAGCGCACCATGCAGCCCCTCACCTCGCGTGGTTCGAAAGTCTTAAGATCGCAGCGG
CAGTGTATATAGCCAGCTTCGTTGCATATTTAAAAAATCAACGTTGAGTCTACAACCTCTCCTCTTTTTTCTGCTACAGTCACACCTCCCTAACTGAGCC
TCTCTACCTGACTATGCGCTCTTTATCTGGTTGTCATCCCTGTGTGCAACTGAGTTTATATGACTTTCACTGAAGAAGTTCTCTAACTGACTAAAACCCT
CCTTATTTTCTAACTGACAGTCCCGGAGGGTGGAGGAACTCCCTAAATGCACGCGTCACAAAGTTATCAAGCCACTTTCACATGTTGATGTGCACTTCTT
CCCTCCGAATCTGACTTCGTCGGTGCAGCCACTTGATGCAGGTAAGCTTTCGGACATATTTGGCTAATGCTTGGTGAACTTACTGATTGATAATATATTT
GTAGGCGTCATCCGATCGTTTAAGGCACGCTACCATCGTCGATTTGTCCGCTGGTGCCTTGACGCAATGGAAGGCGACTCAAGGATCGTAGACGCTACGT
TGTTGGGGGAGCTCCGCCAGGAAGGGGAGTATGCGTTGGCTGCTGAAGAAAGTGTGGTAAACGATATTGTGAGCATGCTGGAGCCCACGACAGTGTTGCC
CATTACTTGGAGATTGATTCTGACGTTGAAATTCACGAGCTCCCAGGAGGCGGTGCCGGGGACGATGATGCTGAAGAGGTGGATGGTGATGTGGACGACG
AGAACGACAAACCCCCTGTGTCAGCATCGACAGCACTCGCCTATTGTATGGAGCTTTCTTCGTTTCTATTCCAGTGTGAAGGGGATACAAAGCGGGAACA
GGAAATGATACAGACCTTGACAATGGTAGCTAGAGACCAAGTAGTGAAGCGGCGGCGGCAGACATCACTGGATACCTTTTTAACACCAATGTAAGTGTAG
CCATTCCCATATCTGACACATTCTCTAAATGAAACAACGTCTCGGATCAGACAGATCGGGCGTCACTTATAGAGGTGTGACTGTATGACATCCCAATCGT
GAGCCCCTGGTGCAGTCATTACAGTAATTAGTCTGTCCTAGACTAATTTTTGTGAGCTGCTTCCAGATCAACTTACACTAATAAATAGTCTGTCACCACC
GCGTACAGACTAATTTTGAACACAGACTACTTTTGAACTCAGACTAATTGTGAACAGGGAACGAAAAAGTATCCATCTTCCCAGTTTAACTACACTAGCG
CCTCGTTGCCTGCATCATTAATCACCACTGGAATCACCATTTCGTTTCCTCCTGAGCCTCATCAAAGCTTCTTCATCGACGGCCACGGTGTCTGTAGTTG
GGGATTTTCCGGCAAACTCCTCAGGGTATTTCTTTATGATTTCCTGTAAGTGCGGGAACAACTGCGTCGTACGCCAAGTTCCATCAACACTAAGTGATAG
GTCACATCGCATCATAGCTTTCTGCGTGTAGTTTATCCCGTTGTGGTCGCGCTTCGCGTTGACTTCCTTGACAGACTATTTTTGAAGCTTTGTTGACAGA
CTAATTATGAACCTTGGGAGTTTTCATTGACAGGAATTAGACTCATTGTGCATACATACTAATTTTGAACACAGACTAATTGTTGTAATGACTGTAGCTG
GTGGCCTGTACAGTACCGGCCATTTACAACCGGGGTTGTATTTCTGGTGATCCTCCATCGCTGCATGGCTGGATGGGCCGTATCAACCACGACTGGTGGC
CGGTACCGTGCTAAAAAGCGGGGTGGCGTTTACAAATTTGGTTGCACGCACGGTGGCAAGATTTGGCCAGTTTTGCGACCCAATCCAATCCAAAAACCAA
GTCAGGGCTGCAAACAGACCCAGTTCAAGGGCCCGCTTAACAACTTAACAAAAACCTGATGGAGGTTGCACTTGATGCAAACGTGCAATGAAGAAGCATG
AACGCACTAAAGTTGCCACGCCAGGTTGATGTTAGCTAGCTCATGACGTGTATACTGTACGAGTACGTGCCTCAGTCCTCAATACTGTACAGGTAAACGC
GGCTACCAGCTACCAGGTGCTCCCGATTGGGATGTCATAGCAGAAAAAAGAGGAGAGGTTGTAGACTCAACGTTGATTTTTTAAATATGCAACGAAGCTG
GCTATATACACTGCCGCTGCGATCTTAAGACTTTCGAACCACGCGAGGTGAGGGGCTGCATGGTGCGCTGCGGGCGAAGACATGGACGACCCACACTTTC
ATCTTAGACACGGACTTAAAAGTCTGCGTCCAGAGTGAACACCTGGTCCTCGGCCGCGACACCCACACCAGCCTTGGAGTACTCGCCCACGCGCTTCTCG
AAGAAGTTGGTCTTGCCCTGCAGCGAGATCATATCCATCCAGTCGAACGGGTTCTTCACGTTGTAGATCTTGGATGCACCCAGTGAGTACAGCAGGCGGT
CGGCCACGAACTCGATGTACTGGCACATGAGCGCAGAGTTCATGCCGATCAGCTCCACGGGGAGCGAGTCGCTCACGAACTCGTGCTCAATCACCACAGC
GTCACGCACGATCGCGTGCACGCGGCTCTCCGGCAGCTTGTTCACCAACTTCGAGTACATGAGGCACGCGAAGTCCGTGTGCATGCCCTCGTCCCGGCTG
ATGAGCTCGTTCGAGAAGCTCAGACCAGGCATGAGGCCGCGCTTCTTGAGCCAGAAGATGGAGCAGAAGGAACCCGAGAAGAAAATGCCCTCCACGGCGG
CGAACGCCAGCAGACGCTCCGGGTAGGACGAAACACGAGGGTCACACCACTTGAGCGCCCAGCGGGCCTTCTTCTCCACGCACGGGATCGTCTCGATGGC
ACGCAGCAAGTGATCCTTCTCCACGGCGTCCTTGATGTACGTGTCGATCAGCAGCGAGTACACCTCCGAGTGGATGTTCTCGATGGCGATCTGGAAGCCG
TAGAAGCAGCGAGCCTCCGGCACTTGCACCTCATTGCTGAAGTTCATCGCCAGGTTCTCGTTCACGATGCCGTCGCTGGCAGCGAAGAATGCCAGCACGT
GCTTGATGAAGTGGCGCTCGTTGTCCGTCAGGTTCCCCCAGTCCTTCAGGTCGTGCACCAGGTCCAGCTCCTCGGCCGTCCAGAACGACGCCTCCGCCTT
CTTGTACATCTGCCACACGTCGTGCTCCTGGATCGGGAACAGCACGAACCGGTTCGGGTTCTCCACAAGGAACGGCTCCGGCTGCAGCTCGCCGTTCACC
TCCTTCAACTTGTACTCGGACATCTCGAGCTTCGGCTCCTCCTTCTTCTCCATTGTTACCTTGGCGAAACCCTCCACGAACTGCGGGCTCAGCTCCTGCT
CCGGCTGCTCCGGCTGCTCCGGCGACTTGTCTGCGGCAGCGCGTTCCAACGAGGCAGCGACCATTCTATCTGGACGGGTTGGGTAGCTGCTTGCTTGCTT
GGTGCAAGAAGAAGCTGAGCGACTGCGCGGTGGAGCTGGAGGAGTCGCTTGAGGAGTAGAGCGCCAAAGCCAAAATGACAAGCAGAAGAGCTCGACTTGC
TCGCCGCGCGCCAACGAGCCACGCTGGCGGAAAAAAGCGCGGGGGCCTGTTGCCTGGTACACGCTGCATAACAACACCTGGTGAAGCAAATGTAGATATT
GAAGGCGAGGACGATGGAGGATGATGTTCATCTGTGGTGTTGTCCACTGCATCTTGAAATGCATCTGATGGTGATTTTTTTCTTGCGGCAACAACGTCGT
TGCCATGTTTTTTAAAACTGGCAAGTTTCTTCACGACCTTGTTTGTCACCTTCGGACACCAATTTGCATCTTTTCGATACATTGACAAGAACACTTTAAA
GGGTAACGTATTGTACTTACCGCTAATTATTAGAGCAGCGAGCGGTGAAGCCGAGCGAGATGTGACCATGCTTGGTTCTGGGTTTAACTCCGCGTGCTGC
GCACACGTATCTTAAACCACACGCGTTGTTTTGGCTTTCAGAACGAGTTGGCATTCACCCCTTCCCTAGCGTGTTTCGACCAAGTGCATGATGTCGTTCG
GTGTGCAATACTTCTATTATACGCTGCAGAGTGCTTGCACTTGTGCAGGGCCCTTTTTATCCTGTCACCGACTCGTTAGCTATACACCGGGAGCTAGCCC
GACTTTTTCTATCAGCGATTTACTTGGATGTGGTGGGCGCCACAGACACCGAGTGCATAAAATCCATGTTCAGACCGTCGTCTTCGTCCTCATCATCGAG
GCTGTCGATGTCAATCATGCTGCTCTCCCGGGGTTGGACAGATGACCGTTCGCTGTATGCACCAGTGGAGCTGCGTGTGAACTTGAACTTCTTCTTCTCT
GTAGCATCATCGATAGCTGGGGGCTCTGAAGCCGGCTGGTCTTCGAGTTTTCGTCCCTCTGATGCAGCGGAGGATGCATGGGACGACCCCACAAACGACG
TAAAAAGATTGTCGTCCTCGCCTTCGAATTCATTCTCTAGGGCATCCACGTGCGTGATCTCGACAGGTGCAGGAGCTGGAGCTGGCATGACGAATTCGTC
AACCGATGGCGGTGATGGTGGATCGCTGCTCGATCCCGTCGAAGAAACTCTATCGCTATAACGCAGCTGAGACGTTGCCGGATCTTCCTTGGGCGTCACT
TGCTTCGCCTGAGAACGCTCTGGGCTGCGGCGCTCGCGTCTGTGGTCTGTTTCCTTGGTTGGGCTTGAGACTGGAGCCGTGTACTTGGGGACGGCGCTGC
CAATAAAGCGGCCTTCCTGGTCAACGGGCATGGTGTTTGACACGGGGTGGTAGTTGGTGAAGTCCTTCACGTCCATCGTATCGCGGAACTGCTCATTTAT
AGGCGATGCATCAGCATTGCCGCCAGCAGCGCCAGCTCCGGCCACCATGTCCGTCGTTAACCAGTCGCGCACTCCCGTGAACGGGAAACCACAGCACGTG
GGGCACTTGGGCGTGGTGGTGAACGTGTGCGGCGAGCATAGCGACGAAACTGCGCAACGCCTTCTTGCGGTAGTTGATCACGACGGGCGTGACGCTCGTG
AAGACGTGCTTACGCGGGAACTCGAAGAGGTTGAGCACCTTCTCGTAATTGCGGCACCCGGGGCATTTCTTGTCCGTCTTGGCGAAGAACTCGAGGAGGT
CGTTGCGCAGCTTGAGGAACTCGGAAAAGCGGCGCGCGACTTCCCATACCTGACCGGAGCGGATGTTGACTACGCGCACGTGGTAGCGCACCTTGCCGTC
CTCGGACGAGTCCACGGTCGGGATCTGCACGCGCACGAGGCACTTTTCATCCACGCGGCCCAGCTCGCCATTGCGCGAGTAAGCGTAGCGCGCGGTGGGG
TTCATCGGCGGAAAGGATCTATCAGGGCGGGGCTTGGACAGTGCGTGCAAGCAGGCGGGTTGGCGAATGACGCATGATATCCGCTTTGCATCGCAGTCGC
CCGACGACGACCAGACGTCGAGAGTGCTTGACGTTCGTATGGAGCTCCTCGAGTAAGACGCCAGGGGTTTCAACAGATTTTCGGCCAATGGGACGGGCCC
GATGGGCCATCATCGAGGTCCCACCTTGATCATAGTTGCATCTAGCTTCAGAGAGTCGGAAATGACTTGATATTTGTATGCCCTCCCAGCGAGATAGCCG
GTACGTTTCACAGAACCTGTGGCTCGGCTCCGATGTGGATTGTGACGTCAGCGTTACGCAAAAATTGTCCCGACATTCGGCTGTCGCTGTCGCCGCACAT
CTGGCCCTGCAGTCTGCAGTGCAGACGGCGGTCTAATGACACTGTCATTATGACCGGCAGCCAAGTCCTGAGGAAAGGGCGTCGGTGCGTGCGCATTGGA
AAGCATCAGCGCTCCAGCGTCTGCCTCACCTCAGTGACGAGGAAACTTCTTAGCCGAGCACGATACCAATAGAGTGGTTTCAGATGGCATCCCAAGCGTA
CCTGGAAGATATATCTGTTTCTGGTTTTGCGCTTCTCGCTGCAATTGTATTCCGGCGCCTTCAATGAACGCAACATCAGTATCCAGCTGAGCAGCGTTAA
TCACGTTTGTATCAGCAGCATGTGCTGCATGGCAGCGGACACTGCTTGGTGTCCCCTGGGATTCGCTCGCCGCACTAACGGTCCTTGGATGGACAGTCGT
GATAAAAATCGTGGTGAGACCAGCGCACGATTCTGGAGGTGGATGACGGGCATGCTGCGGATCACCTGACGATGTGTTCAGGGCGCAACTACGGTCGAGA
AAAGTGGTTTTGCGCTCTCTTATCCAAATGTTGGATCTGAGCGCTTCTTATTCTTGGCTCACGCTGGCAGGCAAGATGCCACAGCATTCTCACCGTCGTT
GGCATACAAATTGCAACGAGCCTTTGTTGGCGGGTGCTACCTAACTATCATCTGCTGTTTTGGCACCAATCGTCTGTTAGGTAGAATACTGTCAATTGCT
CGCAAATGACCTAAATTGCATATTATCGACGTTCCACGTCATACCAGCCGCGCTTCGCGTGACTGTGGTTCGCTTCGCTCGCGATATGAAGATAGAACCT
CGAGCCGCACGCATCGCCCTCACGCTTGAGGCTCCGGCGGAGGGGGGGGGTTCTGTCCCTGCTTTCGCCGTGACGCTGCGGAAAAATAGTGTTTGGCGCT
CAAACAGTCTTCGTGATAGCTTTCTCCTTCCCATTCTTACTCCTAACGTTAGTAGCAGACTGGTAGATAAAAAGAAGTAGTATTGACTATCTGTCGAAAT
GCAACAGGTAAGCAGGGGTTGCAACAGGCGATGGGATCACAGGTAGGCAGGGGCAAAGCAACAGGTATTAGTTATTTTCCCTTGTTGGCCATCACTGTCT
ACACGATTGATTTCGTTGCATCCTTAGCAACTATGCTTGCGGTCTGCTGCCATGCGTGTCCTGACTCGGCTCCTCTGCATCGTCCATCACTTCATCAGCC
TCCGCCCACACTGCAACGCAAAACAAACGATACCGGTAACATGTCAAACTTCCGTCGCTGCATTCATCGTCACTACAGCAATACGCACCTGGTTTGTTGG
ATCCTAGCTTCGGCTTGTCAGGCTTGGCGATGGAGACACGCAGCGTCCGCCCAAACAGCTCCGAATCTAATGATCACAGCCCTTTAGACACTGCCACACC
ACCATCCACAGACCACCATTAAGCATCCACCCACCGTCCATATTGTCAATAGCAGCTCTCGCATCCGCCTCGTCCTCGAACTCCACGAAACCGAAGCCTT
TACTCCTCTCTGCTCCATCAGCCAGTTAGTCGTGCACATGCCAGTATTACACCAACCCAACCCAATCGACGTACGCGTGGAGTATTCCGTGGGGATCTGC
ACAGACTTGACGGGGCCGAAGGGCACGAAGGCCGTGTACAGCCCCTGCTCCGTCACTTGCTTGTCCAGGCCGCCCACGTACAGCGCCCGCTTGTCCGCCT
TGCCCGCCATTCTGTCTTTTTAATGACCGGACTCTCCACTAAGTACGACCTGATCTTTTCCGAAACGCCTATGCAGATTTCGAAAGCCGAGGAGGCGAAG
CAAGTGAGCGCCTCGTTCCCAGCAGGATATCACCATGAGCGCGGCCACGGACGAGCTGTTTAACCAAGGTGCGTGATAGAAGAGAGACGCCTAGGTGGAC
ATGCGCAAGCCATGTTTCGTGCCTCGCCGTGGTTGCGGAGAAATTGCGACGCAAAGTCAGCGCTTGGACTGATAATTGGACGTCTTTTTGCGACAGGTTG
GGGCGACGTGCTGAGCAACATCTCGCCGTATGCGTGGGGCAGCATGGGAGTAGCCTTCGGCTTGGCCTTCTCCATTGTTGGCGCCGCCTGGTGCGTCCTG
CGTCTGATTCCTGAGGGTGGAAGAAGAGAGGCTTACTGTTTTTACTACGTGGTGGCTGGCTGCACAGGGGCATCTTCATCACGGGGTCAAGTCTTCTGGG
CGCTGCTGTGAAGGCCCCGCGCGTGCGATCCAAGAACCTCGTGAGCATCATTTTCTGTGAAGCCACTGCCATCTACGGCGTCATTATCGCTATCATTCTG
CAGAGCAAGGTGTGTTCTCATTGCTGCACTGAGAGCAGTGTGGTTGTTATGTGGAGAGTGCTGATTGAGTGCGTGCTTAAATAACTGGGTAGATGAACCA
ACCGGCACTCCGTAACGAGGGGGATGAACCGATCAATGAACACGCGCTGTACTTCGCAGGATACGCCGTGTTCGGCTCGGGTCTTGCTGTTGGCTTGACG
AACCTTGCCAGCGGGTACGATCTTCGCGTATAACTTTGTAGCTTGTGGACGGGATGGTGAGACTCACCTGTTGCTTGGTGTAGAATTTCCGTCGGGATCG
CTGGCAGCAGTTGCGTGCTTGCTGATGCACAGAATGCTGCGCTGTATGTGACGATTTTGATTGTGGAGATTTTCGCTAGTGCGCTGGGCATCTTCGGTGT
CATTGTCGGCATTA