Description :
From Genome Similarity Track
Location :
Scaffold_28:346081- 348848
Transcript NameFunction/comments
Phyra_97323PrAvh128

Sequence
2767 bases(100 bases per row)
CAACATTCACTGGGCAACGGGTTCTAGCCCGTTGTCGTACAGTGACCTGATCTCTCAGCTCCTAAGCCTCTTCCCAGCTTCTCAGCTATCTTTTTCAACT
TGCCAGGTTCCAGCTGTGCATTCCAACAGTTTGAGGCGACAGGCCTGATTGTCTTGTCGACGAGCTGGGCGTGCTTTGGCTTGAGTTGTGCCTGGTGCTT
CATTTTGAATGATAGTGAAAAAAGGAGCGAAACGCAGGTAAATGCCACTCATTTATACCGTTCAAAAGCGGCAAAACGGAAGGTGGTCTCTATAACAGGG
ATGCAGCAGCAGAACAAACCTAACCGCTTGCTATATTTCGGATTTGGTCGTTTGCTATCTCGGAGCTTATCTCTATTTCAGACCCCCTATCTCGGGATAG
GAGACTTCAAGTTTGCCAAAATGGATGAAAAGCACAGTAATACCGGAGGTCTAAATCTAATCTAAGCTTAAATCTGACTCTGCCTTTGATAAGCCGCGGA
CAAAGGGAGAACCATCAGGAGCGTGAAAATACCGAAGCTATTTGACGTAGAGCATGTTGTGAGACAAAGCAGAGTACTTGGTTTCCACTGCGCTCAACTA
GAGCAGTGGCGCAAACGACGCACTCTTGTTCCGTTTGACAAACATGAGTGGGGCCAAGATATAATGGAGCGATTCCCGCAGCCTTTTGAACTGGTTCAGA
TCCAAGATTTGCCCTAACTCATACATAAAAACCATTCTATTCTTCAATGGTTTAACACTAAATGACTGAGAAACACATACCGGACATGTCCCTTATTCGG
AATGCGGTCAAAAGTTAACTCTGCGAATAATCGCTCGATGCTTCTGCAATTTGGTCATCGTATCGACACTCACTAAACATTTAAATGGTGGAGCCCGTGT
CCTCAGAATCGCTCTGACGTGCAAGTTATTGGAGCGCGAGTGTCGGTGCCGGCGCGTCCAGGAGGCATTTTGGCCGCGGCTTTTGGTGTGAGCCCGGCTT
GATTGCAGAGCTTTTGCATCATAACGCGTACCATACAGTGATACTTACTTCTACAACATGACGACAACAGGGGGCATGTGACCTCTGGACGCTTTCCTTC
ACGAAGAAGCTGTCTTAAACGGTTTATTCCGTGTACATGTAGCTGCATGCTCCTCCTCGTCTAGTCTCCTGTGTTTAGTGAGATAAAGCACCGTTGTTCA
AGGATATGTAATCCACGTTGTTTGAATATGTTTGCGTTTCTGTTTAAGGTGGCGGCCAAATGATGCAAATGTTCGTGTCTATGGTGGAGATCGACCTAGA
CTTACAACAGTGGCGGACAAACAGGCACTTAAACAGGAGCATTCTCTAGCTCATTGTATCTCTATGGTAAGTCTCAACAATATCTTGCGCCGCTCAAATC
TGACTTTAACTAATATTGGCGAATATGGTCTTAAGAAAGTGCCGAAAATCGGTACGGTGTTCTCGGTCATTTAGTGTTAAGAAGTAGTATAGAGAAACGT
AGCCCCCAAATAATAAGGAACCTTCCTTAGTCTCTAAATTTCGAAAATACACCGACGTGTAGTTGAGGCAAATCATGTGAGCCCCGGCCAAACTTCCCGA
TTCAACACCGACAAATACAATTTTCATATTGTGACGAGGTGCTTCGTCGAATTTCAAATTAGTAAGTTCAAGTGATTTCCCGGCCTCGTGTGATTTGTAG
GGCAGGTTTTGGCCGCGTCGATTGAAACGAAAACTGCAAGAGACTCACAAATGGTCGGAAACTCGTTAATGCTCAAAAAGAGAAATGCCGCAGTAAGCAG
TTTACAACTGACGTGTATCTACCACCGGTAGGGTCTTTCACAACTCTGTGGGCGATTTAGGTTGTGATCCCTCGCAGGTGGTACTTGTTGTAGTCCTCCA
CGTACTTCTTCCAAAGTTTCCAGTTCGCATCCGTCTTTTCTTTCACGTGGAACAGTTTGGCAACAGCGACCGGGTCCTTTTTTGCGAAGATGAACTACGT
GAGCACCTCAGTCTCCAACTTGTTTGCAAGATCCTTCGTTTTCGGGTTCTTTTGTGCCGCTGTAATGGCCTTTACCAAATCTTCGTCCTTGTAGATACTC
GACAATACGGTCCGAGGAGCAATCTTACCAGGTAAAGACTTGTGGAAATCATCCATGAACTTCATCCAATATGCGAACATCGGGTTTTTGAACAGCTTTG
AGGGCTTTATCTGATCCAGTTTGAGTGACCTGAAGGCGTCATCCGGAGACTGCATCCAGTCTTTGAATAGTACAGCCTCCATTCGTTTTCCAGCACTCTG
CGCACTTGGTATTTTCTCCGCTGCAAGGATCATTTTAGCGACGTCAAAATCGCTATAGTGGGCCCTCACGATCCAATTCGTAGTCATCTTGATGCCAAGG
TTCTTGGCGTGGTAGGCGTCCGTGAACTTGGTAAACGTGGTGAATAGCGGACTCGACAGAAGATTCTTGCCAGCCTTCTGCAGACCTAACATCATGAAGA
CGTCTGCCGGTTCTTTCCGTTGGCTCATCCAGAGTTTGTACTGCGCAGCATCCAAGTTTGTGGCGAGGTTCGACGTGCTCGGGGCATTTCTTCCCGCCGC
GAGGAGCTTGGATAGACCAACATCTCCGTAGTGAGTCGTTAGCGTCCCAATCAAAGTGGTCTCCTGGTCGGGGTTCCGCTTGTTGTAAATGTTCATGTAC
TTGGTGAAAGTGTTCAAAAGAGGGCTCCCGAGCAGCTTGTCTCCAGCTTTGTCGAGTGCCAAAAACG