Description :
From Genome Similarity Track
Location :
Scaffold_632:3460- 6295
Sequence
2835 bases(100 bases per row)
GAACATATTTGTCTCGGCTGATCTCATAAAAATCCGTTTCCCGCAGCTCATAGAGCACAGAAGAATATATCGCAAAGTCTTCAATGAAGCGACTGTAGTA
ATTTAGGATTCCCAAGAATGGCTGCATTGATCGCAGAGTTCGAGGAAAGGGAATATTCATAATTGAATCTTAATCCGTGGAGTGGGCTTCCGTTTCCTCG
AGCAAAACTTGATGGCTTTTGTAGTCGACCTTGCGACGCCCCTAGAAAATTTTGGCTACACTGATCGATAAGTTTCATCTATCACACACTTCCAACAGCC
GTTCCACCCTTTCATATAGGGAAGTCCATGACGTAGCAGGTATCAAGATGTCGTCGGTATACGATCTTCGACCTAAGACCGACGGTCTAGGGGTTATATC
CAGCACTCCGTCAGTGAACACATCGGTTAGCGTAGATGAAGGTGTTGTACTCGAGTTAGATTTTGGGCCGATCTTCAGATACCCATATAGTGCAATTTCG
ATCAGTTGCTGGTAGATCTGGGGAGCGTTTTTCAACCCAAAAGGCATTCGTAAACATTCAAACAAACCCGAAGGTGTGACGAAAGCGTAAATAGCTTTTG
CTCGTTCTGTCATCTCCACCACCCAAAATTCACTCGCCAGATTCAAAGAGCAATACCACATCGCTTTATCCAGGTCTTGGAGTAATTCGCTAACCAGTGG
CATGTGATATATTATCAATCTTGTCAACTAGTTTACCTTTCTGTAATCAATGCATAGTCGTATATCTTCCCCATTTTTCTTGATGATCGCCACAATAGGG
GAAGCCCAAGGTGAGGTGGATGGTTGAATGATCTTGGCCGATAGTAGTCCCTTGATCAGATCTGCCAGTTTCTCTGGATATTTGGGTTCCACTGGCCGTA
CTCTCTGCGCTATCGGTTTAGCACTGCTGACATCAATATCGCATACCACTCCACGCGCAGCTGGAGGCAGGGCATTCCTCTTCCCTATGAGTAAATGGCG
ATTCTTCCAGATCAGTTGTTGCAACTTCTCTTGATCATCTGTCAGTGGTTTACCTGGGTCGCCGAATTGGATGTCTTCGATAGCCACCTCTACCGTGGGA
GCGACTATTTCTGGCAAGATTGCCATATGTTGGTCCACGTTTTCGGCGAATAGGTCAACCGTGTCATGGCGATATACCGCAGTTTTCGTCGGATTGGTAT
CTGCTGAGTCTTCTTCGTTCGTGGGCGTTGTAGCGCTTTTACTCCCTTAATCTGACAGTTTTGATCCTGATCGTCCTCATCCCAGCAATCATTCTCGATC
GCGACCACCTTTGCTTGTACGATCGCCTCATCTAACCGGTTCTGTGCCGGATCGCCCTTCCCTGCTTTTGCAATCATACTGACCGCAGCAGGCATTTCTA
ACAATAGCTGTTCTTCATTTCAAGGGCGGTCTACATTCTCGATATTAACTCGTTTATCGTGATTTGTAATATCTGACACCCCTGGTTGTGACAAGACCTT
CCCCGATCGGCTTACCCCCGTTTCTTTTTCTTGTTTCTCTCTATGCCTCAGAATCTTCTTGGGATGGTGTACGACGGGTGGTCCAATAGAGGCCCCGAAT
ACTCGATCGGACGTTCTTTGATTAACTTCGTTGTGGCTTCGAATGCCATAGTCGGCGATTCATTATACCGGCGTGATCCCACCTAAACATAACCCGGTGA
TCGAGGTATTATGTCCATCATCATCCGCCACGCTAGATGTGTATCGTGATTGAGAATTACCTCCTGATCGACGATATTGGTTAGTATCAAATACTTGATC
TGTCCGGGGCCAGTAGTAACCGTCGGTACCCACTTCTTGTACCGCCTTACCCATAGTTTGGATTTAGGGAAACCTGCTCCAATCTTCATTTCTGTGGATC
CTCCGACTGGGATTACCACATGTTGATATGGGGTTTATATTTACTCCATATGGAGGTCGTCGCCCTGCCAGGTGAATTTTCACTTCGTCTGGCAAACAAA
GCGTTTCATCCGCTAGGTCCAGACGTATCCCTGCTGGCAACATAAAATCCATACCTAAGATTGCTTCTTGGCCAACTTGATCGCCCACCCAAACGTCAAA
ATAATATACCAGTGATCCGTTTAGTGTGATCTTGATCTTGGTGCATACTTCAGTCATGTAGACGATCTCCCCGATTCCCACACATTCTCGCTTCTGGCTG
TCGTCGATCATACACCTCACCTTACAAGCAAAGGTAACGTCGATGATTGAGACTTCGGCTCCAGAATCGAATAGCATAGTGGCTCTTTCGTTGTTGTTTC
TTGCCCACCGCTTTAGCTTGTTCAAACCACTTTCCAGATACTTCCAATACCCTCTCGACTCACTCGGCGCTAGATCGAGCTCCATGTTAAGAAGAGATCG
CGAATGTTCATCCACCTTCTTCACACTTGAAATATTACGCAAACGATGGTTATCCAAATAACATGTATTAGCGATCGGGCCGATCCGATTGTTGCTCCCT
GATCGATCCTTTCCGTATCCACAAATGCATATATGCATAGCCTAGAACGCTCGGCTCGTGCCAGATTCCAACCTGGCGAGCGTCATAGTTTAACATCTTC
TCCTCCTTGGTCTTGATTAGCCCCGCGTGCTTGGTCGGCACGTACCACATACGAATAATGTTGTAGAACTCCTCCATGCGGCATTGACCGCTCTCATGAA
CCTCCCCACAGGCGGGACACACATGTAGGCATTTTTCCGAGGGATGTACTTTGCGGCCACACTTTTGACAGGTCAATCGTTTCCAACATATGCGATCATC
ATGACTTTTCGAGCCACAGTGTGTGCAGGCTTTCG