Description :
From Genome Similarity Track
Location :
Scaffold_606:3460- 5103
Transcript NameFunction/comments
Phyag_g6974hypothetical protein PHYSODRAFT_483689

Sequence
1643 bases(100 bases per row)
TGTGGCGGACCAAGCCTCTGTCGGTGATCCAGGCCGAGGAGAGAGCGGAGGATATCCCGCGCACGTTAGGTATGTTCGACCTCTGTTGTGTGGGTATCGG
TGGAACGATTGGTTCgggcatcttctccaccgctggATCCATCATCTCAGAGACTGCAGGCcctgctgccgtcgtcaGTTGGCTGATCGGTGGAGTCATT
TGCTGTCTCAATGCACTGGCCTACATGGAGCTGACTACGCGTGTGCCGTCCTCGGGAAGTACGTACGCGTACGCGTACCACACGATTGGAGAGCTAcctg
ccgtcgtcgctgcatgGCTGCTGACCCTCGAGTACGCTGtctctggtgctggtgtggCGCGTAGCTGGGGAGACAAGGTTGAAGAGTGGCTGCTGATTGA
ATACCCAGACAAGAGCTTCCACTGGCTTAACCTGCAGTCGGCAAACCTCAGCGGCGGACTCATCCAGTTCCTGAgcatggtggtgctgctgatgggCGTC
CGCTTCGGCAAAGCTTTCGTGAACACCGTCACGATGATCAAGATGTGCGTCGTGGcgttcatcatcatcgccgGTTTCGCTGCCATGAACACTGACAACT
TGTCGCCGTTCGTCCCCACGCGCACCGAGTTGGACGGCACGATGGCTTTCGGAACGCAGGGCATTATCACTGGTGCTTCGCAGGCGTTCTTCGGCTATGT
TGGTTTCGACGAGATTTGCTGCCTTGCCGGTGAGACCAAGAACCCCAAGAAGATTATGCCCATTGCCGTCATGACCGTTGTGGTCGGCACGATGGTTCTG
AGCGCTCTTTGCTCTCTCGTGTTGGCGGGCATGGTGACTTATCTCGACGCGGGCAGTTTTGGCGATGGTTTCGAGGGTCACGGTTGGAAGTGGGCGGGAA
CGATTGTGCGTGCTGGTGAGGTGGTGACCATGCCTGTCGTGGCGTTGATTGGATTCTTGGCGCAACCACGCGTGAATTACGCGCTCGCTTGCGACGGCCT
GCTGCCGCGCATCTTCGCAGAGGTGGATTCCAAGGGCAACCTGTTCAAGAACACGCTCATCACGGGTCTGTTCTTCACGGTGATCGCCATCGTGGTGCCC
TTCGACACCTTGTGGGACATTGTGAACTTCGGTGTCATGATGTCGTTTATTATCGCCAACGTATCGCTGACGCTGGCGCGTATGAAGCCCCAGTCGCCCA
AGCTGTCACCGATGTTGGTCGCTGCGCTGGTCGTGTCCGCTGGATTCACAGCCTTCCTGTACCAAGAAGGCTACGAGAACAGCTCTTCCACCGCGTGTCT
GGTTCTGGCTATTATTTTCCTCGTCATCACCGTGGGTATCTCAGTGGCGCTCTACATCAAGTGTCCGCAGACTGCCAACTCTCCCGGTCTGTTCTCCGCT
CCGCTGGTGCCGTTCATCCCGATGATCTGCATCCTGGCCGACTGGTACATGATCGCGCAGATCGGCCACTTGGCACTTGGTCTCAGTGTCGCTTGGATGG
CAGTCGGCGCGCTCTCCTACTTCGTCTACGGCTACTTCCACGCAGAGTCGCGCAACGACTGGAACCGGTTGATGGGCAGCCTCCCCATTCACGGTGACAG
TCTCTCAGCCCCAATGCTCTCGGCCAAGTACTCGGTGCAGGAC