Description :
From Genome Similarity Track
Location :
Scaffold_290:3460- 4653
Transcript NameFunction/comments

Sequence
1193 bases(100 bases per row)
GGTACTGCTTCAGTCACCCGACGTAGAACGTCGGGTATAACCGTAGCGATGATGGTATGTCCAATGTGTAGGCATCACTGATTACTTTCATAGCCAATAA
AGCGCAGTGCGAGTTTGTTCGCACCAAGATTTGTTGCAGCCCAAGAGCGAATGCCGTCTGCCAACAGGAGCGCGCGATCTCTTGTATACATGTAGCCACA
TTCTTGCTCTCACACTTGTCGTTCTCCTTCTACTTGTCCACTGCTTCTTGCAGTGCATCTCATACAAGTAGGGCGACCGATTCTCGCTGCAGCACGAACT
CAGAGATGGCTGCATCGTCGACTGGACGCGCCGGAGTCTTCGGCGTGTAGTTAGCTACGACAGGATTGGTAGCGTGACCAGGGTTGATCAACGTGTGCGC
AGCCCAATCTGCGAGCGGAGATGCCGCACTGTTCGACGTCGCAAGGATCTGTTTCGAGCGGGTGATCACATTCAGCTTCACGGACTTGTGAGCTGCATCC
GCCGAGTGAGCTGGTGGGGTGTGCCATCCGTGCTCATCACTAGTAATACCGGTATCGGTATCGGAACCGGTGTGTCTATGATCGTACTACCAGCAAAGTC
ATTTCCTTCCCCACCCAGAGTGGAGCCACGAGGCGTCGTGGGGTGGCCCACGCGAGGAGGGCGGGAACGCGCGGGTGCCGCGCGATATTCACGAAAAAGG
GGTCAGCCCCGGCGACGCGTGTTCCGTGTTGTTCAGCGCAAACTCGGCAGGTGGCAAGAAGGAGCTCCAACTCGTGAACGAGGTCGCGTAGCTTCGAAGG
ACATCTTCGAAGACTCGGTTGACCCGCTCCGTCTGTCCATCCTTCTCCAGATGCGTCGCCGTTGACATGAGCAGCTTCGTTTCCAGAAGCTGGAAGAGGC
TCGACCAGACCGCCGATGTGAACTGAGGATTGCGGTCAGAGGTGATCGATTCGGATAAGCCGTGGTGTCGAAAGGCCGCATTAACGAAATGCACCACGGA
CTCAGCCGCGGTGATCATGTCGGACACCGGAATGAGTTGCGCCATCTTGCTGAACCTATCAACGAACACTACACCAATTCGACCATTCACATTAGGCGGA
AGCCCGAAGATGAAGTCTATCAACACTGAGCGTCACGCCTCAGTTGCAATCGGTAGGGCTCGCAGGGAAACCTGCGACGACTTCGACGGCTTC