Description :
From Genome Similarity Track
Location :
Scaffold_3374:346- 1409
Transcript NameFunction/comments
Phypl_g15792hypothetical protein PHYSODRAFT_342937

Sequence
1063 bases(100 bases per row)
GAGGCCGCTCTACCACACGTCTATGCATatgtggccaagaagccgacAGAGGTGGTTAGTGAAagatcgacgacttcgaACGGTAATCCATGTGAATCGA
ATCCGCCACGTACCGTGCAAGATCGCGTTGCCCAAGTCTTGGCTATCCGGCACGAAAACGATTACGCGAGAGAGCCGCCACTGGATGTGATCAACCTGCA
GCCCGGTGAACGTCGTGGTTACTGGAAGTACTACGCACCAGACAAGTGGCATAGTCAGGCGAAGATTCAAGGAAAGTTGAACAACCGTCGTGccgtgttg
ctgctcgatACAGGTGCCGAAGTGTCCATACTGGACGCTACCTTTGCTCGTGAGGTAGGCTGTCTGATCGACACGAACGTGACACAAGACTGCGTTGGAA
TCCGAGATGAGGCGTATCACACGGTGGGGAGAACGAAGATCAAGGTTACCATGGCGGGTAACTTGGTCTACTTCCTGGACCTTTGGGTCGGGGACTTGGT
CGACCAGCACGCGATCTTGGGGATGAATTTCATGGTACCGGCCGGAGTACGCATCGACGCCACGGACGGCACTGCCTGTTTACCCGATGAGGTGCGTATC
CAGCTCATCGGAAGGCGGCCGCTCTACGGCGCGAAGATGTGCCCGATCAACCTTACGTCGCTCGTGAAGATCGACCCGGGACGGACGCACGATGTGCGCC
TCCGCTCGGACCGAAACGCGCCGCGGCTGTGGGTCACGATAGGTAAAACGTGGGTCACCAGCTTCGTGAAAGGCAAGATCGGGAGACGAACGTACCTACG
CGTGACCAacgtcggcgacgaagcgATCACACTCGACGCCCACACGACGTTGGGCTGGTGGACGCCCGTGGACCTCCTACCGCGCGCTTTTGGCTCCGTC
CGGCTGGAGTCTCGACGCTACCGAGAGTGGCAGAACCTGGCTTACGGCGCCACTTGCAACGCCGATGAAGACGGGACGAATGCCGAACCTGAGCCAGAAG
GACCAATGACCGAACGCCCGGTATACGAGATCCCGCAAGGGGTCATGCGCCGTGGCGAGGAGA