Description :
From Genome Similarity Track
Location :
contig_26:34595- 35625
Transcript NameFunction/comments
g6720.t1hypothetical protein

Sequence
1030 bases(100 bases per row)
GGAACAGCGTGAAACCGCTGCTCGAGCTTCGGTGTCACCATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAG
GGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTC
TTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTCAGCACGTATGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTT
TGAGTCCCCACAAAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAATCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTG
GTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAG
AGTATCCAAATACTCTCGAGGCTGCAATTGCGCTCGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCC
ACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGGACCAATGGACCTCTCGAGTGCGACCGCTGCTGGGAACCAGCAGCGTCGTGGATCAACGAATGTGCGT
TGTTTCCGCTGCGGAAACATCGGCCACTATGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCAATACTGGGTATCGTCACGGGC
AATCAAAAAACTAAAGGGACCAGCAGGGCGCCCCGCGCCTGCTGGTGATGCAGTCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCC
AGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAGGTCTCTTCGTGCTCTAGTGG
ACTATGGTGCGTCGAACAACTTTGTTCGAC