Description :
From Genome Similarity Track
Location :
Scaffold_765:3458- 5251
Sequence
1793 bases(100 bases per row)
CAGAGGTGGTGGTCATTCGACCCGACATCATAGAGCTAAACTCTTCTTCACTTTTGGATGAAGCTGTTCTAGAGGACACAAAAGCAGCACTCAGTGCGCG
TAGTAAGTCCTCAATATTGAAAGGCCCTCATGATCCCTTTTATCCCTTAGTCAAGGAATTTCAAAATGTGTGTGCCACGACCCACCCTCTGTTCTACCTC
CAGATAGAGGTGTCCGTCATGAAATTGACTTAGATCCTGGGACGGAATACTGTGTCACACGACAGTGGCACTTGACTAAGGAGCAATGTGAGGTCATTGA
TGATTTCTTCCGTGACAAGCACGAGGCAGGAATGGTACGTGAGAGTAAATCTCCGCATTCGACACCGACGTTTTGTGTCAAAAAGCCGACCAGCAAGTGG
CATATTGTGCATGCTTATAACAAGCTTAATGCGGCTACTATTCCGGCACAAACACTCATTCCTCGAAAGGATTTTCTTCAGAACAACATGATTGGTTGTA
CTATGTATAACGCACTCGACTTGTTCGATGGATATTATCAATTTCTTATGCAAGCTAGTGATAGTCCGCTTACAGCAGTAAGCACTCCGAGTGGTATGCT
ATGGGAATGGCTGGTGATGCCCCAAGGGATGTCTAATGCTCCGGCAACATTTAATCTTCTGGTCACACAGCTTTTCCGCCCACATCGGGATTACGCACAG
ACGTACTTTGGTGACATTTTTGTCCATAGTCGTGCCGAACAAGGTCGGTCAGATGTTGACAACCACATCGATCATTTGCGAGCCGTGCTCGAGTGCATGC
GCACTAATAAATTGTACGCCAAACGCGTCTAAATGCATTTCTGGTGCAGAAGAGATTCCTTTTCTAGAATGTTTCATTAGTAAGCGCGGCCTTAGAGCGG
ATCCCGCTAAGGTCAAGGCTATAGTGGACTGACCGATTCCTAAGAATCAAAAGGACTTGCGTAAGTGGCTTGGCCTTGCCAATTACTTGCACAAATACAG
TGAAAATTACGCTGATATGGCTCGGCCATCAACTGATCTCCTTAAGAAGGACACAGATCGGCGTTGGGACAACACCCATACTGATGCATTTCGGGAAATA
AAGTAGAGTCTCCTTCATGCTCCCATTTTGGCGTTGCCAAATCCTGAGTACCCTTTTAGTGTTATCTGCGATGCAGCCAACTTTGTCATAGGCAGCACCC
TGTTACAAACAGATGTTGCAGGCCACGAGCGAGTTATCGCATTTTAATCTAGTCAGCTCAATGCTGTTGAAAAGAACTATCCAGTTCATGAAAAAGTGCT
ACTTGCTATGAAGTATGCGCTCGCCAAATTCAGAGTCCATCTGCTTGGCTCCAAGCAATTCGTCGTCGATACGGATCATGCGTCACTACGCACGGCAACA
CAGTCGCCTCACCTCTCTCAGAGAATGGCTCGGTGGCTTTCCTTCTTTGCGGAACATAACTTCGAGGTGAAGTATAATACAGACAATCAAAAGGGGTTGG
CATATGCCCTCTCTAGCCATCCCGATTATGAGCTTGTCCATGTCACGACTCTGTCGTCTCCTATTGAGGAGTTAATTCGTGTGGCATACCCACGGGATTC
TCAATGTGTGGCATTGTTTCATGCCCTTGGGAGTGAGGAGTGCAAAGCCTCGGACAGCCATTTGTCGGCACGGTTGCGTGCCAGCCTACATCGATATTCC
ATCAACAATGGTCTCTTGTGCTATCGCACAGATGTAGCGGATACCGCTCGCATTGTTGTACCTCACGATGAGGATTTAGATTATCGAATCCTT