Description :
From Genome Similarity Track
Location :
contig_38:345711- 354410
Transcript NameFunction/comments
g7126.t1hypothetical protein PHYSODRAFT_284208
g7127.t1hypothetical protein PHYSODRAFT_284208
g7128.t1hypothetical protein PHYSODRAFT_470319
g7129.t1H - or Na -translocating F-type, V-type and A-type ATPase (F-ATPase) Superfamily

Sequence
8699 bases(100 bases per row)
ATGTACTCGAAGTTGGTGAACAAGCTGCCGGAGAGCCGCGTGCACGCGATCGTGCGTGACGCTGTGGTGATTGAGCACGAGTTCGTGAGCGACTCGCTCC
CCGTGGAGCTGATCGGCATGAACTCTGCGCTCATGTGCCAGTACATCGAGTTCGTGGCCGACCGCCTGCTGTACTCACTGGGTGCATCCAAGATCTACAA
CGTGAAGAACCCGTTCGACTGGATGGATATGATCTCGCTGCAGGGCAAGACCAACTTCTTCGAGAAGCGCGTGGGCGAGTACTCCAAGGCTGGTGTGGGT
GTCGCGGCCGAGGACCAGGTGTTCACTCTGGACGCAGACTTTTAAGTCCGTGTCTAAGATGAAAGTGTGGGTCGTCCATGTCTTCGCCCGCAGCGCACCA
TGCAGCCCCTCACCTCGCGTGGTTCGAAAGTCTTAAGATCGCAGCGGCAGTGTATATAGCCAGCTTCGTTGCATATTTAAAAAATCAACGTTGAGTCTAC
AACCTCTCCTCTTTTTTCTGCTACAGTCACACCTCCCTAACTGAGCCTCTCTACCTGACTATGCGCTCTTTATCTGGTTGTCATCCCTGTGTGCAACTGA
GTTTATATGACTTTCACTGAAGAAGTTCTCTAACTGACTAAAACCCTCCTTATTTTCTAACTGACAGTCCCGGAGGGTGGAGGAACTCCCTAAATGCACG
CGTCACAAAGTTATCAAGCCACTTTCACATGTTGATGTGCACTTCTTCCCTCCGAATCTGACTTCGTCGGTGCAGCCACTTGATGCAGGTAAGCTTTCGG
ACATATTTGGCTAATGCTTGGTGAACTTACTGATTGATAATATATTTGTAGGCGTCATCCGATCGTTTAAGGCACGCTACCATCGTCGATTTGTCCGCTG
GTGCCTTGACGCAATGGAAGGCGACTCAAGGATCGTAGACGCTACGTTGTTGGGGAGCTCCGCCAGGAAGGGGAGTATGCGTTGGCTGCTGAAGAAAGTG
TGGTAAACCATATTGTGAGCATGCTGGAGCCCACGACAGTGTTGCCCATTACTTGGAGATTGATTCTGACGTTGAAGTTCACGAGCTCCCAGAAGGCGGT
GCCGAGGACGATGATGCTGAAGAGGTGGATGGTGATGTGGACGACGAGAACGACAAACCCCCTGTGTCAGCATCGACAGCACTCGCCTATTGTATGGAGC
TTTCTTCGTTTCTATTCCAGTGTGAAGGGGATACAAAGCGGGAACAGGAAATGATACAGACCTTGACAATGGTAGCTAGAGACCAAGTAGTGAAGTGGCG
GCGGCAGACATCACTGGATACCTTTTTAACACCAATGTAAGTGTAGCCATTCCCATATCTGACACATTCTCTAAATGAAACAACGTCTCGGATCAGACAG
ATCGGGCGTCACTTATAGAGGTGTGACTGTATGACATCCCAATCGTGAGCCCCTGGTGCAGTCATTACAGTAATTAGTCTGTCCTAGACTAATTTTGTGA
GCTGCTTCCAGATCAACTTACACTAATAAATAGTCTGTCACCACCGCGTACAGACTAATTTTGAACACAGACTACTTTTGAACTCAGACTAATTGTGAAC
AGGGAACGAAAAAGTATCCATCTTCCCAGTTTAACTACACTAGCGCCTCGTTGCCTGCATCATTAATCACCACTGGAATCACCATTTCGTTTCCTCCTGA
GCCTCATCAAAGCTTCTTCATCGACGGCCACGGTGTCTGTAGTTGGGGATTTTCCGGCAAACTCCTCAGGGTATTTCTTTATGATTTCCTGTAAGTGCGG
GAACAACTGCGTCGTACGCCAAGTTCCATCAACACTAAGTGATAGGTCACACCGCATCATAGCTTTCTGCGTGTAGTTTATCCCGTTGTGGTCGCGCTTC
GCGTTGACTTCCTTGACAGACTATTTTTGAAGCTTTGTTGACAGACTAATTATGAACCTTGGGAGTTTTCATTGACAGGAATTAGACTCATTGTGCATAC
ATACTAATTTTGAACACAGACTAATTGTTGTAATGACTGTAGCTGGTGGCCTGTACAGTACCGGCCATTTACAACCGGGGTTGTATTTCTGGTGATCCTC
CATCGCTGCATGGCTGGATGGGCCGTATCAACCACGACAGGTGGCCGGTACCGTGCTAAAAAGCGGGGTGGCGTTTACAAATTTGGTTGCACGCACGGTG
GCAAGATTTGGCCAGTTTTGCGACCCAATCCAATCCAAAACCAAGTCAGGGCTGCAAACAGACCCAGTTCAAGGGCCCGCTTAACAACTTAACAAAAACC
TGATGGAGGTTGCACTTGATGCAAACGTGCAATGAAGAAGCATGAACGCACTAAAGTTGCCACGCCAGGTTGATGTTAGCTAGCTCATGACGTGTATACT
GTACGAGTACGTGCCTCAGTCCTCAATACTGTACAGGTAAACGCGGCTACCAGCTACCAGGTGCTCACGATTGGTATGTCATAGCAGAAAAAAGAGGAGA
GGTTGTAGACTCAACGTTGATTTTTTAAATATGCAACGAAGCTGGCTATATACACTGCCGCTGCGATCTTAAGACTTTCGAACCACGCGAGGTGAGGGGC
TGCATGGTGCGCTGCGGGCGAAGACATGGACGACCCACACTTTCATCTTAGACACGGACTTAAAAGTCTGCGTCCAGAGTGAACACCTGGTCCTCGGCCG
CGACACCCACACCAGCCTTGGAGTACTCGCCCACGCGCTTCTCGAAGAAGTTGGTCTTGCCCTGCAGCGAGATCATATCCATCCAGTCGAACGGGTTCTT
CACGTTGTAGATCTTGGATGCACCCAGTGAGTACAGCAGGCGGTCGGCCACGAACTCGATGTACTGGCACATGAGCGCAGAGTTCATGCCGATCAGCTCC
ACGGGGAGCGAGTCGCTCACGAACTCGTGCTCAATCACCACAGCGTCACGCACGATCGCGTGCACGCGGCTCTCCGGCAGCTTGTTCACCAACTTCGAGT
ACATGAGGCACGCGAAGTCCGTGTGCATGCCCTCGTCCCGGCTGATGAGCTCGTTCGAGAAGCTCAGACCAGGCATGAGGCCGCGCTTCTTGAGCCAGAA
GATGGAGCAGAAGGAACCCGAGAAGAAAATGCCCTCCACGGCGGCGAACGCCAGCAGACGCTCCGGGTAGGACGAAACACGAGGGTCACACCACTTGAGC
GCCCAGCGGGCCTTCTTCTCCACGCACGGGATCGTCTCGATGGCACGCAGCAAGTGATCCTTCTCCACGGCGTCCTTGATGTACGTGTCGATCAGCAGCG
AGTACACCTCCGAGTGGATGTTCTCGATGGCGATCTGGAAGCCGTAGAAGCAGCGAGCCTCCGGCACTTGCACCTCATTGCTGAAGTTCATCGCCAGGTT
CTCGTTCACGATGCCGTCGCTGGCAGCGAAGAATGCCAGCACGTGCTTGATGAAGTGGCGCTCGTTGTCCGTCAGGTTCCCCCAGTCCTTCAGGTCGTGC
ACCAGGTCCAGCTCCTCGGCCGTCCAGAACGACGCCTCCGCCTTCTTGTACATCTGCCACACGTCGTGCTCCTGGATCGGGAACAGCACGAACGGTTCGG
GTTCTCCACCAGGAACGGCTCCGGCTGCAGCTCGCCGTTCACCTCCTTCAACTTGTACTCGGACATCTCGAGCTTCGGCTCCTCCTTCTTCTCCATTGTT
ACCTTGGCGAAACCCTCCACGAACTGCGGGCTCAGCTCCTGCTTCCGGCGACTTGTCTGCGGCAGCGCGTTCCAACGAGGCAGCGACCATTCTATCTGGA
CGGGTTGGGTAGCTGCTTGCTTGCTTGGTGCAAGAAGAAGCTGAGCGACTGCGCGGTGGAGCTGGAGGAGTCGCTTGAGGAGTAGAGCGCCAAAGCCAAA
ATGACAAGCAGAAGAGCTCGACTTGCTCGCCGCGCGCCAACGAGCCACGCTGGCGGAAAAAAGCGCGGGGGTCTGTTGCCTGGTACACGCTGCATAACAA
CACCTGGTGAAGCAAATGTAGATATTGAAGGCGAGGACGATGGAGGATGTTCATCTGTGGTGTTGTCCACTGCATCTTGAAATGCATCTGATGGTGATTT
TTTCTTGCGGCAACAACGTCGTTGCATGTTTTTAAAAACTGGCAAAGTTTCTTCACGACCTTGTTTGTCACCTTCGGACACCAATTTGCTTTTCGATACA
TTGACAAGAACACTTTACAGGGTAACGTATTGTACTTACCGCTAATTATTAGAGCAGCGAGTGGTGAAGCCGAGCGAGATGTGACCATGCTTGGTTCTGG
GTTTAACTCCGCGTGCTGCGCACACGTATGTTAAACCACACGCGTTGTTTTGGCTTTCAGAACGAGTTGGCATTCACCCTTCCCTAGCGTGTTTCAACCA
AGTGCATGATGTCGTTCGGTGTGCAATACTTCTATTATACGCTGCAGAGTGCTTGCACTTGTGCAGGGCCCTTTTTATCCTGTCACCGACTCGTTAGCTA
TACACCGGGAGCTAGCCCGACTTTTTCTATCAGCGATTTACTTGGATGTGGTGGGCGCCACAGACACCGAGTGCATAAAATCCATGTTCAGACCGTCGTC
TTCGTCCTCATCATCGAGGCTGTCGATGTCAATCATGCTGCTCTCCCGGGGTTGGACAGATGACCGTTCGCTGTATGCACCAGTGGAGCTGCGTGTGAAC
TTGAACTTCTTCTTTTCTGTAGCATCATCGATAGCTGGGGGCTCTGAAGCCGGCTGGTCTTCGAGTTTTCGTCCCTCTGATGCAGCGGAGGATGCATGGG
ACGACCCCACAAACGACGTAAAAAGATTGTCGTCCTCGCCTTCGAATTCATTCTTAGGGCATCCACGTGCGTGATCTCGACAGGTGCAGGAGCTGGAGCT
GGCATGACGAATTCGTCAACCGATGGCGGTGATGGTGGATCGCTGCTCGATCCCGTCGAAAAACTCTATCGCTATAACGCAGCTGAGACGTTGCCGGATC
TTCCTTGGGCGTCACTTGCTTCGCCTGAGAACGCTCTGGGCTGCGGCGCTCGCGTCTGTGGTCTGTTTCCTTGGTTGGGCTTGAGACTGGAGCCGTGTAC
TTGGGGACGGCGCTGCCAATAAAGCGGCCTTCCTGGTCAACGGGCATGGTGTTTGACACGGGGTGGTAGTTGGTGAAGTCCTTCACGTCCATCGTATCGC
GGAACTGCTCATTTATAGGCGATGCATCAGCATTGCCGCCAGCAGCGCCAGCTCCGGCCACCATGTCCGTCGTTAACCAGTCGCGCACTCCCGTGAACGG
GAAACCACAGCACGTGGGGCACTTGGGCGTGGTGGTGAACGTGTGCGGCGAGCATAGCGACGAAACTGCGCAACGCCTTCTTGCGGTAGTTGATCACGAC
GGGCGTGACGCTCGTGAAGACGTGCTTACGCGGAACTCGAAGAGGTTGAGCACCTTCTCGTAATTGCGGCACCCGGGGCATTTCTTGTCCGTCTTGGCGA
AGAACTCGAGGAGGTCGTTGCGCAGCTTGAGGAACTCGGAAAAGCGGCGCGCGACTTCCCATACCTGACCGGAGCGGATGTTGACTACGCGCACGTGGTA
GCGCACCTTGCCGTCCTCGGACGAGTCCACGGTCGGGATCTGCACGCGCACGAGGCACTTTTCATCCACGCGGCCCAGCTCGCCATTGCGCGAGTAAGCG
TAGCGCGCGGTGGGGTTCATCGGCGGAAAGGATCTATCAGGGCGGGGCTTGGACAGTGCGTGCAAGCAGGCGGGTTGGCGAATGACGCATGATATCCGCT
TTGCATCGCAGTCGCCCGACGACGACCAGACGTCGAGAGTGCTTGACGTTCGTATGGAGCTCCTCGAGTAAGACGCCAGGTTTCAACAGATTTTCGGCCA
ATGGGACGGGCCCGATGGGCCATCATCGAGGTCCCACCTTGATCATAGTTGCATCTAGCTTCAGAGAGTCGGAAATGACTTGATATTTGTATGCCCTCCC
AGCGAGATAGCCGGTACGTTTCACAGAACCTGTGGCTCGGCTCCGATGTGGATTGTGACGTCAGCGTTACGCAAAAATTGTCCCGACATTCGGCTGTCGC
TGTCGCCGCACATCTGGCCCTGCAGTCTGCAGTGCAGACGGCGGTCTAATGACACTGTCATTATGACCGGCAGCCAAGTCCTGAGGAAAGGGCGTCGGTG
CGTGCGCATTGGAAAGCATCAGCGCTCCAGTGTCTGCCTCACCTCAGTGACGAGGAAACTTCTTAGCCGAGCACGATACCAATAGAGTGGTTTCAGATGG
CATCCCAAGCGTACCTGGAAGATATATCTGTTTCTGGTTTTGCGCTTCTCGCTGCAATTGTATTCCGGCGCCTTCAATGAACGCAACATCAGTATCCAGC
TGAGCAGCGTTAATCACGTTTGTATCAGCAGCATGTGCTGCATGGCAGCGGACACTGCTTGGTGCCCCTGGGATTCGCTCGCCGCACTAACGGTCCTTGG
ATGGACAGTCATGATAAAAATCGTGGTGAGACCAGCGCACCATTCTGGAGGTGGATGACGGGCATGCTGCGGATCACCTGACGATGTGTTCAGGGCGCAA
CTACGGTCGAGAAAAGTGGTTTTGCGCTCTCTTATCCGAATGTTGGATCTGAGCGCTTCTTATTCTTGGCTCACGCTGGCAGGCAAGATGCCACAGCATT
CTCACCGTCGTTGGCATACAAATTGCAACGAGCCTTTGTTGGCGGGTGCTACCTAACTATCATCTGCTGTTTTGGCACCAATCGTCTGTTAGGTAGAATA
CTGTCAATTGCTCGCAAATGACCTAAATTGCATATTATCGACGTTCCACGTCATACCAGCCGCGCTTCGCGTGACTGTGGTTCGCTTCGCTCGCGATATG
AAGATAGAACCTCGAGCCGCACGCATCGCCCTCACGCTTGAGGCTCCGGCGGGGGGGGTTCTGTCCCTGCTTTCGCCGTGACGCTGCGGAAAAATAGTGT
TTGGCGCTCAAACAGTCTTCGTGATAGCTTTCTCCTTCCCATTCTTACTCCTAACGTTAGTAGCAGACTGGTAGATAAAAAGAAGTAGTATTGACTATCT
GTCGAAATGCAACAGGTAAGCAGGGGTTGCAACAGGCGATGGGATAACAGGTAGGCAGGGGCAAAGCAACAGGTATTAGTTATTTTCCCTTGTTGGCCAT
CACTGTCTACACGATTGATTTCGTTGCATCCTTAGCAACTATGCTTGCGGTCTGCTGCCATGCGTGTCCTGACTCGGCTCCTCTGCATCGTCCATCACTT
CATCTGCCTCCGCCCACACTGCAACGCAAAACAAACGATACCGGTAACATGTCAAACTTCCGTCGCTGCATTCATCGTCACTACAGCAATACGCACCTGG
TTTGTTGGATCCTAGCTTCGGCTTGTCAGGCTTGGCGATGGAGACACGCAGCGTCCGCCCAAACAGCTCCGAATCTAATGATCACAGCCCTTTAGACACT
GCCACACCACCATCCACAGACCACCATTAAGCATCCACCCACCGTCCATATTGTCAATAGCAGCTCTCGCATCCGCCTCGTCCTCGAACTCCACGAAACC
GAAGCCTTTACTCCTCTCTGCTCCATCAGCCAGTTAGTCGTGCACATGCCAGTATTACACCAACCCAACCCAATCGACGTACGCGTGGAGTATTCCGTGG
GGATCTGCACAGACTTGACGGGGCCGAAGGGCACGAAGGCCGTGTACAGCCCCTGCTCCGTCACTTGCTTGTCCAGGCCGCCCACGTACAGCGCCCGCTT
GTCCGCCTTGCCCGCCATTCTGTCTTTTTAATGACCGGACTCTCCACTAAGTACGACCTGATCTTTTCCGAAACGCCTATGCAGATTTCGAAAGCCGAGG
AGGCGAAGCAAGTGAGCGCCTCGTTCCCAGCAGGATATCACCATGAGCGCGGCCACGGACGAGCTGTTTAACCAAGGTGCGTGATAGAAGAGAGACGCCT
AGGTGGACATGCGCAAGCCACGTTTCGTGCCTCGCCGTGGTTGCGGAGAAATCGCGACGCAAAGTCAGCGCTTGGACTGATAATTGGACGTCTTTTTGCG
ACAGGTTGGGGCGACGTGCTGAGCAACATCTCGCCGTATGCGTGGGGCAGCATGGGAGTAGCCTTCGGCTTGGCCTTCTCCATTGTTGGCGCCGCCTGGT
GCGTCCTGCGTCTGATTCCTGAGGGTGGAAGAAGAGAGGCTTACTGTTTTTACTACGTGGTGGCTGGCTGCACAGGGGCATCTTCATCACGGGGTCAAGT
CTTCTGGGCGCTGCTGTGAAGGCCCCGCGCGTGCGATCCAAGAACCTCGTGAGCATCATTTTCTGTGAAGCCACTGCCATCTACGGCGTCATTATCGCTA
TCATTCTGCAGAGCAAGGTGTGTTCTCATTGCTGCACTGAGAGCAGTGTGGTTGTTATGTGGAGAGTGCTGATTGAGTGCGTGCTTAAATAACTGGGTAG
ATGAACCAACCGGCACTCCGTAACGAGGGGGATGAACCGATCAATGAACACGCGCTGTACTTCGCAGGATACGCCGTGTTCGGCTCGGGTCTTGCTGTTG
GCTTGACGAACCTTGCCAGCGGGTACGATCTTCGCGTATAACTTTGTAGCTTGTGGACGGGATGGTGAGACTCACCTGTTGCTTGGTGTAGAATTTCCG