Description :
From Genome Similarity Track
Location :
Scaffold_43:345660- 348675
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012509Protein of unknown function
Pytul_DAOMBR144PYU1_G012508Similar to DDB_G0271670: Uncharacterized protein DDB_G0271670 (Dictyostelium discoideum)

Sequence
3015 bases(100 bases per row)
CAGAATGTGACTGATCTGGAAGCGTTGTCTGACGTCGAAGGATTGGACGTCGCGTATGGTATCGTGACCAACTACCTCGAGTGGATCTTCATTATTGATG
ACGACGTGGCTGTACGACAATATCAATGTACGCTCCTTGTGTCAAACACATTGCCCGAGAATGAATCACTGAAAAAATCATAGGAACAATTTGTGAAATG
CTGAACGGTGAACCGTCCCTCTAAGTCATATTGAGGAACGCTAATAAAGTCAAGAACACCAAAGGAAATGGTAAAATATATATTTTTTGTTTGAAAAATA
GCAACTGCAGGCACTAGACGCAACAAACACCCTTTTGTTTTTGTATGTTCATACTGCTACTGCACACGGACGCACCTTTGGAAAGCACGTGCTGGTATGC
ACACAAATCTCCTATTGCTGGAACTGGAAGGTGCTGCCGCTAGAAGCTTGTGGAAAGTTTCCATAGGCAGCTGCTTGTGGGTTGGCGTTCGCCTGCATCA
TGGCGTTCATCGCGTACTGCTGCTGTTGCTGCTGCTGCATCCACTGGGCCTGCATCTGTGGGTTCATCATCTGTGGGTTCATCATCTGGCCCGCGTGCAT
TGGGTGCATGCCGTTAGCCAGCATCGGGTTCATCATGGCGCCAGCGGGGACCATCGCGCCGACAGCGGCACCGCCAACCATCTGTGGGTGCATCGGCATC
ACGGGAGTCGGCGGCTCCGAGGAGCCCTTGGCCTTCTGCAGATCGTTCAGCGTGCGGCGCTCCGACGGCGCAGTCGTGCTGTCCTTTTTCTCACTCGCCA
ACGACGTCAGATCAACAATGTTGTTCTCCGGCAGTAACGATGTCGTAAATTGCTGTTGCTGTGGTGGCGCCGGAGTCTGTTCCTGCTGCGCATTAGCTGT
AGACTGACCAAAGATCGATGGCTGCTGCGCCATGCTGTTGTTGTCATTCGCTTGAAACGAATTTGCTGAGAAACTCAATCCTGCAAGTTCTGTTAGCGTA
AACACAAAAAGCGATACGATCAGTACGCGACACAACACCAATGGACATGGCCATAATGCGCATACCTTGCAATGGATTCGCACTCAGCGACACAGGCGCT
TCGTCGAAGATCGATGGCGTAGCCGTGTGAGGTTGCGCTACTGCAACCGGTTCGCTGTCAAAGCCAACGCCCAAGAGGTCCACAGTAGTGACAGCAGCAG
CTGCAGTTTTGGAACTCTTGGAATTGCTTTTTCCCGATCGCTTCTTGGACTTTTGGTTCTCCTTATCCGACGTTGCGGCAACGTCCGACTCGGACGATTC
CATCGACTGACGACGACCGCGCGACTTAGACGATTTCTTGGACTTGGAGTGCTTGGAGGACTTGGTGTCCTTCTTGGATCCTTCACTATCGTCGGCAGGC
GGCGGCGGCAGTTTCGACGGGTCGAACGAGTACGAGTAGTTGGCAGCAGAAGACGACATCGTGGCCGCAGCCTGTGACTTGGAGTTGCTCTTCTTCTTAC
GATCCTTCTTGTCGTCGCTGTCGCTCGCGCTGTTGTCGTCGTCATCTTCCGAGTAAAACGACGCCTTCTTGTCTCTCTTGCTGCTGTACTTTTTGCTTTT
CGATTTGGCGCTCTTGCTTCGTCGCCCGTGGCCAGTCGAATGATCCGAATCGCTCGCTGAATCCGCAGCGGCCGAAGATGCGTCTGAACGTGCCGATGAC
GCGTCCGAGTCCGACTCATACTTCTTCGATTTGCGGTGCTTGCCGCTCGATTCGCTCTTCTTTTTGGCGCGACGGCGATCCTTCCGGTTGTCCGCGTCGT
TATGGCGGTGATGGTGGCTCTGGTGACTCGATCGCGAGCTCGAGAACGCATTGGATCCCGAATTGCTGAAGCCGTTGCTGTTGCGGTTGCCGTTGAATGC
GCCGCCGCCGCCGCCACTGTAGCTATCCGAGTACGCCTTCGGTCGCTCCGTCGCGAAATCATTCTGATACGTCGTCGAGTTGGAGAAGCTGTTGTTGTGG
TAGCTCCCGCCATTGCTGTAGCTTCCTCCTCCACCTCCACCATTCGGCGCGTTCGTGAACGACGAGCTGCGGATGTCCGCCATCCAGTTGGCGCGGCCGT
CGTTGCGCGGGCCTTGCGCCATGTGGTCGGGGATCGAGTCGTGCGAGCCCGCGCCGCGCGCGAGCTTCCCGCCGTACTCGATTACCTTGCCGCCGAGCCA
CTGGCCGCCCTCGAGGATCTTGTTCTTCCAGTCGCCGCTCGCGCCATTGTTCATGGCACCGCCGCCGCCGTAGTTGTCGTACGGACCACTGCCGCCGCTG
CCGCCGTGGCCGAAGCGGTTGCGGCTGTGGAAGTTGCCGCCCGACGTGATGCTCGAGCCCTCGACCGACTTTTGCATCCACATGCTGCCCTGTGCGTGTG
TGTGTCTCGAGTCTGCGGGGAATGCGCGAATGACGCTCCTCTCCCTTGTGGCGCTCGCTTTGGGAGCTTCCAGATTTTTTTGTTGCCTTCTCAGACCAGG
TGGCAGGTGGCAGGTGGGTAGGCACCTCACACCTGTTTAGTTGGATATCCCTTACAAAAGAGACACCTGATTCGACAGTATGAATAACAAAATAACCTGT
CTAATTGGATGTTATGATGGCTGAGCGCAGAATGATTGCGACAGAGGTTGTGGCGGGAAAAAAAGGGAAGCAAAAAAAAAAATGAGCGAAATGGACGGCA
GCGGCGTGGCGGAGGAAGAGGTGCGGCTGCTGGAGGCCATGGCCGCCGTCTCCAAGAGCATGCAGCAGGTAACGCGCCATTCTGTCCACTATGTGCGTGT
GTCCACGTAATGACAACGCCTGACGCGCTATCTGTTACGACAGCTCAACGGCGTACTCACGACGCTCAATCGGCAGACCGTTGCGCTCTCCCAGGAACTC
GCGACGGCCGAGCGCCAAATGGTACGTGCTTATTTGCGTATGCATTCGCTATGTGATGATGAGTGTGGCTTTGCTTAGTGACTGTCTGACGTTGTGGATG
GTGGCGTGCGTGTGT