Description :
From Genome Similarity Track
Location :
scaffold_38:345631- 354351
Transcript NameFunction/comments
g12748.t1 hypothetical protein PHYSODRAFT_284208
g12749.t1 hypothetical protein PHYSODRAFT_284208
g12750.t1 cleavage induced hypothetical protein
g12751.t1 hypothetical protein PHYSODRAFT_470319

Sequence
8720 bases(100 bases per row)
CACCAAGCAAGCAAGCAGCTACCCAACCCGTCCAGATAGAATGGTCGCTGCCTCGTTGGAACGCGCTGCCGCAGACAAGTCGCCGGAGCAGCCGGAGCAG
GAGCTGAGCCCGCAGTTCGTGGAGGGTTTCGCCAAGGTAACAATGGAGAAGAAGGAGGAGCCGAAGCTCGAGATGTCCGAGTACAAGTTGAAGGAGGTGA
ACGGCGAGCTGCAGCCGGAGCCGTTCCTGGTGGAGAACCCGAACCGGTTCGTGCTGTTCCCGATCCAGGAGCACGACGTGTGGCAGATGTACAAGAAGGC
GGAGGCGTCGTTCTGGACGGCCGAGGAGCTGGACCTGGTGCACGACCTGAAGGACTGGGGGAACCTGACGGACAACGAGCGCCACTTCATCAAGCACGTG
CTGGCATTCTTCGCTGCCAGCGACGGCATCGTGAACGAGAACCTGGCGATGAACTTCAGCAATGAGGTGCAAGTGCCGGAGGCTCGCTGCTTCTACGGCT
TCCAGATCGCCATCGAGAACATCCACTCGGAGGTGTACTCGCTGCTGATCGACACGTACATCAAGGACGCCGTGGAGAAGGATCACTTGCTGCGTGCCAT
CGAGACGATCCCGTGCGTGGAGAAGAAGGCCCGCTGGGCGCTCAAGTGGTGTGACCCTCGTGTTTCGTCCTACCCGGAGCGTCTGCTGGCGTTCGCCGCC
GTGGAGGGCATTTTCTTCTCGGGTTCCTTCTGCTCCATCTTCTGGCTCAAGAAGCGCGGCCTCATGCCTGGTCTGAGCTTCTCGAACGAGCTCATCAGCC
GGGACGAGGGCATGCACACGGACTTCGCGTGCCTCATGTACTCGAAGTTGGTGAACAAGCTGCCGGAGAGCCGCGTGCACGCGATCGTGCGTGACGCTGT
GGTGATTGAGCACGAGTTCGTGAGCGACTCGCTCCCCGTGGAGCTGATCGGCATGAACTCTGCGCTCATGTGCCAGTACATCGAGTTCGTGGCCGACCGC
CTGCTGTACTCACTGGGTGCATCCAAGATCTACAACGTGAAGAACCCGTTCGACTGGATGGATATGATCTCGCTGCAGGGCAAGACCAACTTCTTCGAGA
AGCGCGTGGGCGAGTACTCCAAGGCTGGTGTGGGTGTCGCGGCCGAGGACCAGGTGTTCACTCTGGACGCAGACTTTTAAGTCCGTGTCTAAGATGAAAG
TGTGGGTCGTCCATGTCTTCGCCCGCAGCGCACCATGCAGCCCCTCACCTCGCGTGGTTCGAAAGTCTTAAGATCGCAGCGGCAGTGTATATAGCCAGCT
TCGTTGCATATTTAAAAAATCAACGTTGAGTCTACAACCTCTCCTCTTTTTTCTGCTACAGTCACACCTCCCTAACTGAGCCTCTCTACCTGACTATGCG
CTCTTTATCTGGTTGTCATCCCTGTGTGCAACTGAGTTTATATGACTTTCACTGAAGAAGTTCTCTAACTGACTAAAACCCTCCTTATTTTCTAACTGAC
AGTCCCGGAGGGTGGAGGAACTCCCTAAATGCACGCGTCACAAAGTTATCAAGCCACTTTCACATGTTGATGTGCACTTCTTCCCTCCGAATCTGACTTC
GTCGGTGCAGCCACTTGATGCAGGTAAGCTTTCGGACATATTTGGCTAATGCTTGGTGAACTTACTGATTGATAATATATTTGTAGGCGTCATCCGATCG
TTTAAGGCACGCTACCATCGTCGATTTGTCCGCTGGTGCCTTGACGCAATGGAAGGCGACTCAAGGATCGTAGACGCTACGTTGTTGGGGGAGCTCCGCC
AGGAAGGGGAGTATGCGTTGGCTGCTGAAGAAAGTGTGGTAAACGATATTGTGAGCATGCTGGAGCCCACGACAGTGTTGCCCATTACTTGGAGATTGAT
TCTGACGTTGAAGTTCACGAGCTCCCAGAAGGCGGTGCCGAGGACGATGATGCTGAAGAGGTGGATGGTGATGTGGACGACGAGAACGACAAACCCCCTG
TGTCAGCATCGACAGCACTCGCCTATTGTATGGAGCTTTCTTCGTTTCTATTCCAGTGTGAAGGGGATACAAAGCGGGAACAGGAAATGATACAGACCTT
GACAATGGTAGCTAGAGACCAAGTAGTGAAGTGGCGGCGGCAGACATCACTGGATACCTTTTTAACACCAATGTAAGTGTAGCCATTCCCATATCTGACA
CATTCTCTAAATGAAACAACGTCTCGGATCAGACAGATCGGGCGTCACTTATAGAGGTGTGACTGTATGACATCCCAATCGTGAGCCCCTGGTGCAGTCA
TTACAGTAATTAGTCTGTCCTAGACTAATTTTTGTGAGCTGCTTCCAGATCAACTTACACTAATAAATAGTCTGTCACCACCGCGTACAGACTAATTTTG
AACACAGACTACTTTTGAACTCAGACTAATTGTGAACAGGGAACGAAAAAGTATCCATCTTCCCAGTTTAACTACACTAGCGCCTCGTTGCCTGCATCAT
TAATCACCACTGGAATCACCATTTCGTTTCCTCCTGAGCCTCATCAAAGCTTCTTCATCGACGGCCACGGTGTCTGTAGTTGGGGATTTTCCGGCAAACT
CCTCAGGGTATTTCTTTATGATTTCCTGTAAGTGCGGGAACAACTGCGTCGTACGCCAAGTTCCATCAACACTAAGTGATAGGTCACACCGCATCATAGC
TTTCTGCGTGTAGTTTATCCCGTTGTGGTCGCGCTTCGCGTTGACTTCCTTGACAGACTATTTTTGAAGCTTTGTTGACAGACTAATTATGAACCTTGGG
AGTTTTCATTGACAGGAATTAGACTCATTGTGCATACATACTAATTTTGAACACAGACTAATTGTTGTAATGACTGTAGCTGGTGGCCTGTACAGTACCG
GCCATTTACAACCGGGGTTGTATTTCTGGTGATCCTCCATCGCTGCATGGCTGGATGGGCCGTATCAACCACGACAGGTGGCCGGTACCGTGCTAAAAAG
CGGGGTGGCGTTTACAAATTTGGTTGCACGCACGGTGGCAAGATTTGGCCAGTTTTGCGACCCAATCCAATCCAAAAACCAAGTCAGGGCTGCAAACAGA
CCCAGTTCAAGGGCCCGCTTAACAACTTAACAAAAACCTGATGGAGGTTGCACTTGATGCAAACGTGCAATGAAGAAGCATGAACGCACTAAAGTTGCCA
CGCCAGGTTGATGTTAGCTAGCTCATGACGTGTATACTGTACGAGTACGTGCCTCAGTCCTCAATACTGTACAGGTAAACGCGGCTACCAGCTACCAGGT
GCTCACGATTGGTATGTCATAGCAGAAAAAAGAGGAGAGGTTGTAGACTCAACGTTGATTTTTTAAATATGCAACGAAGCTGGCTATATACACTGCCGCT
GCGATCTTAAGACTTTCGAACCACGCGAGGTGAGGGGCTGCATGGTGCGCTGCGGGCGAAGACATGGACGACCCACACTTTCATCTTAGACACGGACTTA
AAAGTCTGCGTCCAGAGTGAACACCTGGTCCTCGGCCGCGACACCCACACCAGCCTTGGAGTACTCGCCCACGCGCTTCTCGAAGAAGTTGGTCTTGCCC
TGCAGCGAGATCATATCCATCCAGTCGAACGGGTTCTTCACGTTGTAGATCTTGGATGCACCCAGTGAGTACAGCAGGCGGTCGGCCACGAACTCGATGT
ACTGGCACATGAGCGCAGAGTTCATGCCGATCAGCTCCACGGGGAGCGAGTCGCTCACGAACTCGTGCTCAATCACCACAGCGTCACGCACGATCGCGTG
CACGCGGCTCTCCGGCAGCTTGTTCACCAACTTCGAGTACATGAGGCACGCGAAGTCCGTGTGCATGCCCTCGTCCCGGCTGATGAGCTCGTTCGAGAAG
CTCAGACCAGGCATGAGGCCGCGCTTCTTGAGCCAGAAGATGGAGCAGAAGGAACCCGAGAAGAAAATGCCCTCCACGGCGGCGAACGCCAGCAGACGCT
CCGGGTAGGACGAAACACGAGGGTCACACCACTTGAGCGCCCAGCGGGCCTTCTTCTCCACGCACGGGATCGTCTCGATGGCACGCAGCAAGTGATCCTT
CTCCACGGCGTCCTTGATGTACGTGTCGATCAGCAGCGAGTACACCTCCGAGTGGATGTTCTCGATGGCGATCTGGAAGCCGTAGAAGCAGCGAGCCTCC
GGCACTTGCACCTCATTGCTGAAGTTCATCGCCAGGTTCTCGTTCACGATGCCGTCGCTGGCAGCGAAGAATGCCAGCACGTGCTTGATGAAGTGGCGCT
CGTTGTCCGTCAGGTTCCCCCAGTCCTTCAGGTCGTGCACCAGGTCCAGCTCCTCGGCCGTCCAGAACGACGCCTCCGCCTTCTTGTACATCTGCCACAC
GTCGTGCTCCTGGATCGGGAACAGCACGAATCGGTTCGGGTTCTCCACAAGGAACGGCTCCGGCTGCAGCTCGCCGTTCACCTCCTTCAACTTGTACTCG
GACATCTCGAGCTTCGGCTCCTCCTTCTTCTCCATTGTTACCTTGGCGAAACCCTCCACGAACTGCGGGCTCAGCTCCTGCTCCGGCTGCTCCGGCTGCT
CCGGCGACTTGTCTGCGGCAGCGCGTTCCAACGAGGCAGCGACCATTCTATCTGGACGGGTTGGGTAGCTGCTTGCTTGCTTGGTGCAAGAAGAAGCTGA
GCGACTGCGCGGTGGAGCTGGAGGAGTCGCTTGAGGAGTAGAGCGCCAAAGCCAAAATGACAAGCAGAAGAGCTCGACTTGCTCGCCGCGCGCCAACGAG
CCACGCTGGCGGAAAAAAGCGCGGGGGCCTGTTGCCTGGTACACGCTGCATAACAACACCTGGTGAAGCAAATGTAGATATTGAAGGCGAGGACGATGGA
GGATGATGTTCATCTGTGGTGTTGTCCACTGCATCTTGAAATGCATCTGATGGTGATTTTTTTCTTGCGGCAACAACGTCGTTGCCATGTTTTTTTAAAA
CTGGCAAGTTTCTTCACGACCTTGTTTGTCACTCTTCGGACACCAATTTGCATCTTTTCGATACATTGACAAGAACACTTTAAAGGGTAACGTATTGTAC
TTACCGCTAATTATTAGAGCAGCGAGCGGTGAAGCCGAGCGAGATGTGACCATGCTTGGTTCTGGGTTTAACTCCGCGTGCTGCGCACACGTATCTTAAA
CCACACGCGTTGTTTTGGCTTTCAGAACGAGTTGGCATTCACCCCTTCCCTAGCGTGTTTCGACCAAGTGCATGATGTCGTTCGGTGTGCAATACTTCTA
TTATACGCTGCAGAGTGCTTGCACTTGTGCAGGGCCCTTTTTATCCTGTCACCGACTCGTTAGCTATACACCGGGAGCTAGCCCGACTTTTTCTATCAGC
GATTTACTTGGATGTGGTGGGCGCCACAGACACCGAGTGCATAAAATCCATGTTCAGACCGTCGTCTTCGTCCTCATCATCGAGGCTGTCGATGTCAATC
ATGCTGCTCTCCCGGGGTTGGACAGATGACCGTTCGCTGTATGCACCAGTGGAGCTGCGTGTGAACTTGAACTTCTTCTTTTCTGTAGCATCATCGATAG
CTGGGGGCTCTGAAGCCGGCTGGTCTTCGAGTTTTCGTCCCTCTGATGCAGCGGAGGATGCATGGGACGACCCCACAAACGACGTAAAAAGATTGTCGTC
CTCGCCTTCGAATTCATTCTCTAGGGCATCCACGTGCGTGATCTCGACAGGTGCAGGAGCTGGAGCTGGCATGACGAATTCGTCAACCGATGGCGGTGAT
GGTGGATCGCTGCTCGATCCCGTCGAAGAAACTCTATCGCTATAACGCAGCTGAGACGTTGCCGGATCTTCCTTGGGCGTCACTTGCTTCGCCTGAGAAC
GCTCTGGGCTGCGGCGCTCGCGTCTGTGGTCTGTTTCCTTGGTTGGGCTTGAGACTGGAGCCGTGTACTTGGGGACGGCGCTGCCAATAAAGCGGCCTTC
CTGGTCAACGGGCATGGTGTTTGACACGGGGTGGTAGTTGGTGAAGTCCTTCACGTCCATCGTATCGCGGAACTGCTCATTTATAGGCGATGCATCAGCA
TTGCCGCCAGCAGCGCCAGCTCCGGCCACCATGTCCGTCGTTAACCAGTCGCGCACTCCCGTGAACGGGAAACCACAGCACGTGGGGCACTTGGGCGTGG
TGGTGAACGTGTGCGAAGCGAGCATAGCGACGAAACTGCGCAACGCCTTCTTGCGGTAGTTGATCACGACGGGCGTGACGCTCGTGAAGACGTGCTTACG
CGGGAACTCGAAGAGGTTGAGCACCTTCTCGTAATTGCGGCACCCGGGGCATTTCTTGTCCGTCTTGGCGAAGAACTCGAGGAGGTCGTTGCGCAGCTTG
AGGAACTCGGAAAAGCGGCGCGCGACTTCCCATACCTGACCGGAGCGGATGTTGACTACGCGCACGTGGTAGCGCACCTTGCCGTCCTCGGACGAGTCCA
CGGTCGGGATCTGCACGCGCACGAGGCACTTTTCATCCACGCGGCCCAGCTCGCCATTGCGCGAGTAAGCGTAGCGCGCGGTGGGGTTCATCGGCGGAAA
GGATCTATCAGGGCGGGGCTTGGACAGTGCGTGCAAGCAGGCGGGTTGGCGAATGACGCATGATATCCGCTTTGCATCGCAGTCGCCCGACGACGACCAG
ACGTCGAGAGTGCTTGACGTTCGTATGGAGCTCCTCGAGTAAGACGCCAGGGGTTTCAACAGATTTTCGGCCAATGGGACGGGCCCGATGGGCCATCATC
GAGGTCCCACCTTGATCATAGTTGCATCTAGCTTCAGAGAGTCGGAAATGACTTGATATTTGTATGCCCTCCCAGCGAGATAGCCGGTACGTTTCACAGA
ACCTGTGGCTCGGCTCCGATGTGGATTGTGACGTCAGCGTTACGCAAAAATTGTCCCGACATTCGGCTGTCGCTGTCGCCGCACATCTGGCCCTGCAGTC
TGCAGTGCAGACGGCGGTCTAATGACACTGTCATTATGACCGGCAGCCAAGTCCTGAGGAAAGGGCGTCGGTGCGTGCGCATTGGAAAGCATCAGCGCTC
CAGTGTCTGCCTCACCTCAGTGACGAGGAAACTTCTTAGCCGAGCACGATACCAATAGAGTGGTTTCAGATGGCATCCCAAGCGTACCTGGAAGATATAT
CTGTTTCTGGTTTTGCGCTTCTCGCTGCAATTGTATTCCGGCGCCTTCAATGAACGCAACATCAGTATCCAGCTGAGCAGCGTTAATCACGTTTGTATCA
GCAGCATGTGCTGCATGGCAGCGGACACTGCTTGGTGTCCCCTGGGATTCGCTCGCCGCACTAACGGTCCTTTGGATGGACAGTCATGATAAAAATCGTG
GTGAGACCAGCGCACCATTCTGGAGGTGGATGACGGGCATGCTGCGGATCACCTGACGATGTGTTCAGGGCGCAACTACGGTCGAGAAAAGTGGTTTTGC
GCTCTCTTATCCAAATGTTGGATCTGAGCGCTTCTTATTCTTGGCTCACGCTGGCAGGCAAGATGCCACAGCATTCTCACCGTCGTTGGCATACAAATTG
CAACGAGCCTTTGTTGGCGGGTGCTACCTAACTATCATCTGCTGTTTTGGCACCAATCGTCTGTTAGGTAGAATACTTGTCAATTGCTCGCAAATGACCT
AAATTGCATATTATCGACGTTCCACGTCATTACCAGCCGCGCTTCGCGTGACTGTGGTTCGCTTCGCTCGCGATATGAAGATAGAACCTCGAGCCGCACG
CATCGCCCTCACGCTTGAGGCTCCGGCGGAGGGGGGGGGTTCTGTCCCTGACGCTGCGGAAAAATAGTGTTTGGCGCTCAAACAGTCTTCGTGATAGCTT
TCTCCTTCCCATTCTTACTCCTAACGTTAGTAGCAGACTGGTAGATCAACAGAAAAGTAGTATTGACTATCTGTCGAAATGCAACAGGTAAGCAGGGGTT
GCAACAGGCGATGGGATCACAGGTAGGCAGGGGCAAAGCAACAGGTATTAGTTATTTTCCCTTGTTGGCCATCACTGTCTACACGATTGATTTCGTTGCA
TCCTTAGCAACTATGCTTGCGGTCTGCTGCCATGCGTGTCCTGACTCGGCTCCTCTGCATCGTCCATCACTTCATCTGCCTCCGCCCACACTGCAACGCA
AAACAAACGATACCGGTAACATGTCAAACTTCCGTCGCTGCATTCATCGTCACTACAGCAATACGCACCTGGTTTGTTGGATCCTAGCTTCGGCTTGTCA
GGCTTGGCGATGGAGACACGCAGCGTCCGCCCAAACAGCTCCGAATCTAATGATCACAGCCCTTTAGACACTGCCACACCACCATCCACAGACCACCATT
AAGCATCCACCCACCGTCCATATTGTCAATAGCAGCTCTCGCATCCGCCTCGTCCTCGAACTCCACGAAACCGAAGCCTTTACTCCTCTCTGCTCCATCA
GCCAGTTAGTCGTGCACATGCCAGTATTACACCAACCCAACCCAATCGACGTACGCGTGGAGTATTCCGTGGGGATCTGCACAGACTTGACGGGGCCGAA
GGGCACGAAGGCCGTGTACAGCCCCTGCTCCGTCACTTGCTTGTCCAGGCCGCCCACGTACAGCGCCCGCTTGTCCGCCTTGCCCGCCATTCTGTCTTTT
TAATGACCGGACTCTCCACT