Description :
From Genome Similarity Track
Location :
contig_8:345557- 347051
Transcript NameFunction/comments
g1866.t1OWZ10675.1 Amino Acid/Auxin Permease [Phytophthora megakarya

Sequence
1494 bases(100 bases per row)
CCCACTCCAACCCAAGCGTCTCAACAACCATGGGCAAGCCCTTCTTCACGATGGAGGATGCCAAGGCGTCTTTCAATCTCTTTGCTGCGTCTACGGCATT
GGTACGCTTGGCATGCCGGGCAACTTCTCGCGTGCTGGTCCAGCTCTCGCGATCGTCGCTATGGCCTTCATGGCCTTCTCCAACATCTACGGTGCAGGTG
GCCATCTGCCGCGTCATGCTGCTCGCGCCAACGTCCGTCAAGACGTACGGCGACCTGGGCGAGTGGGCCATGGGCAAGTGGGGTCGCTACCTCACTGTCA
TTGCCCAGATGGGAAACTGCTTGATCGTGCCCTGCGTGTTCCTGGTGCTTGGAGGCACTCTACTGGACGGACTCTACCCTGGCGCCTTCAGCACGACGAC
GTGGTCTATCCTCATGGCGCTCACGGTGTTGCCCGTGTGCCTCGTGCCGACTCTGAAGGAAGGTGCCGGCGCTGCATTCGCGGGCTGCATGGGTACGCTC
GTTGCGGACGTTATCGGCATTGCAGTCGTCATGCACGGCATGCGTGGACACCCGACGGCGCCTTCCCCCGATCTCAACTTTAAGCAAGTCGTTGGTGCCT
TCGGCAACCTGGCTCTCGCGTACGGTGCTGGCATTGTGATTCCGGCCCTCCAACGTCAACACAGTGACCCCACCCGCATGCCCGCGTCGTGTTCGTCACG
ATGGCTTTCACTACGTGCTGCTTCCTGGTGCTTGCTAGCACGGCGTACTCGTCGGTTGGCTGCCAGATTTCCGGCAACCTGCTGTGGTCTATTTACCCAC
AGGAGGACACTGGTTTGACCACTCTGGGCTTCTCCTCGGACTGGGGTGCCATCGTGCTCGCGTACATGTTCATGCAGCTGCACATTACCATCGCATTCTC
CGTTATCCTGAACCCTGCCTTCTACATCACCGAGCGCTTCTTCTTGGGCATGCACCAGCGCACACCCGAGGACATCGAGAACAACCTGCTGAGTTACGCG
GAGGCTGCCACGCCGAACGACGCCGACCACCTGGATAAGTCTCGTGTTTCGAAACGATCCTTCATTTCTGTTGCCGACAACGAAAACGTTCACCTCGGTG
AGCCTGAGGCCGAATCTGCTGAGTACCGCGGCGCGAACGCCATCAAGTACGTCATGCTGCGTATCGCGATTATCGTGCTACTGGTGATTGCATCAGTGGT
CTTGAAGGACCACTTCGCGGACTTGTCCGACTTCGTTGGCGCGTCGTGCATTACGATGCACTCGATTATCCTGCCGATCGTGTTCCTGATGAAGAAGCAG
TGGACCGTGATGCCGATTTGGGAGAAAGTCACGTCCGTGATTGTCACGGTCGTGTGCTTCTGCCTCGGCTGCTACGTGACGTACACGTCAGGCGAGAATC
TCTTCCCGGACGACGACGGCGTGGAATTCCCCTTCTGCGAGCCGGAGTTTGAGAACACTGTGTACTACAACTACACGGCGGCGCACGAAAACTA