Description :
From Genome Similarity Track
Location :
scaffold_44:345475- 346700
Transcript NameFunction/comments
Plaha_PHALS_05792hypothetical protein
Plaha_PHALS_05793calcitonin gene-related peptide-receptor component protein
Plaha_PHALS_05794splicing factor isoform 1

Sequence
1225 bases(100 bases per row)
AACGCTCAACGTCGACAGGAGTAAGGCGGAGATGAGTGGCAGGGCGACGCTGAATCCGCAATCTTGGGTGCCTAGGCCAAATTGAAGTACTTTTTATTGA
TAATTTTTAGCTTTTAGTTCGAGGGATTAAGGACCGAATTGTAGCCCTAGAGACTTGTAGTTTACCAATCAAATGCACTAATATTATTGTGCCACAAGAC
CATGAAGGTGCTGCTTATCAATGAAGAAACGCTAACGGACTTCGAAGTGCTCTCGCTTATAAAGGAGCGCAAGGATCAGAGGCTGCACAAATCTGCTATG
GTCGAGTATGCTGAGCGCAACTGGATGGACCACAAGATTCTGAAATTCCTGACGCAAAGCCATTCATACTGCTCTACATTAAACGCGAACTGCATTCAAA
ACTTTGTCAAGGAGTTAGCGCAGGCAGATCTACCACCGCTAAGCACAGCTGAGCAGTTGCAATTTATCAATCATATTCCTACTGAGCTTGTGGACATTCA
CATGCTCATCGAAGATTGCGCTGAACGATTTACGGAAGCCCAAATAGACGAGCTTATTCACATTGTCACACGCACATTGGCGGTGGAGTTGCTGCAGCGA
CGGAAGGACCAAGCTGCTCAGGCAGAAAAGTAGACCATAGTGGTCAAAAATTAGATAATAGAAGCGCTTAGACAGACGAGGAAATTTAAGGCCTTTCGAA
GTGATTGAGGACCCAAACGGATAACAAGCTCGCTTCCACTTGTTGCGGTAACTACGGACAAAATGCAGAATCAGACTCATTTTTGCGCCATTGTACTACT
TATAAACGTAAAGTAGTAAATCACCTGTCCGCTTTCGGAGCTAATTTTCCTCCTGGCATTGATGCTGGTCCAATTTTCTGCGTAAATGGGCACGTAAGTA
GAAGATAGAGTGTTGTTTCTTGCTTACTGAGAATTAGCACGAGCGGTCTGGACAGCAGATCGAGCTTCAGGAAACATGCCGACGTACTCCTGCGACGACA
AGTACCTGACACTAATCTGTCGCTTATTAAACCAGCGACCGTGTAATTTCTTGGCGGCAGCTACAGCACTCTGTACATTTCCAAAGAGGACATACACCAG
ACCACCTTGCTTGTCCTTTTCCACGTATGTATGTAGCACGGGTCCATATTGACTGCACTCTTCttgaacgtcttgttggatcTCGACGGACCACTCAGTA
TTTCCACTCTTTTGCTCCTGGTAAA