Description :
From Genome Similarity Track
Location :
Scaffold_28:345391- 353054
Sequence
7663 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCACTTGGATTTGATGCGGACGGGCGTCTTCGTTGTGTCG
ATCCGCTCGATCCTGTATCGCACTCCGCAGCCGTTCGTTCACTTGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCT
CGGTTTCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCC
TGTCTTGGGCGGTGTTCATCGCAAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGAT
CGTCTGCACCATGCGTTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAA
TCAGACATAAAGCCTGGCTCCCGATCATATGTCTAATCATCTCGCTAGCCCCAAATCTTCGGAAAATGCACTCCTCGTACGATTCAGCAATGGTTTGCGC
AGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGGTCCACCCAGATCAACAATTCTGTGTTTCCTTTGAACGACTGGGGCAACGAGGGG
ATGTGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCA
CACATTCCCCGACATATCGTTGCACGCTCTTGAACAGTCCCCGCCAGTGGAAACATTCCCGGATCCGTTGATAGGTCCGACCAATTCCCTGATGTCCACC
TTCTAAACTAGCGTGATAGTGATGTAGGAAATCCTGTTGTAAGGTCTCCAGCATCACCCGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTA
GGGGGACAATAAAAGAGCAAGTCATTCAGATCCACTGCATAATCGGTAAAGATAATACTATAGGATTTGGTATCCTCCCGACTTAGTTCTCGTACATCCC
CATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCTTCGTTTCTGTGCTTTGAGGATCCGCTCAATGCGGACTCCCTTCACAAATGCTTCATCGAGAAT
CTGGGGGCTGGATCCCAATCCTTTCTTCTCTGTGTAAGGGGACCAATAGAAGAGCAAGTCATTCAGATCCATTGCGTAATCCGTAGCGATAATACTGTAG
GATTTGGTATCATCCCGACTCAGGTTTCGTACATCCCCCATCAGAGACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTCCTGTGCTTTGAGAACCCGCT
CAATGCGGACTCTCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTAACGGCCATCACCTGGACTGTCCTTTT
CCCATATCCAACTACCACCACTTCGTCTAGTCGATTCAACGTAACGAGAACCTGATGCTCGACCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAA
GCGGCACTGGCCAAGCTATCCGCACTGTCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCACTTTCTGCC
GTAATAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGTCGTTTTGGATCTTG
TCCCTTTAGTAAATCCAAACCCAGAAGGAGCCCGTTATATTCCGCTTCATTGATGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCAT
CCGGGCAGTCTCCACAGTATTGCGCTGTATGCTCCTCCTCCGCATCCTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCCACCTGTA
CCGTCGGGATCGAGATCTGGACCCGGCGTTTGGGCTCTTTCTTAGGAGCGATGCTAGTCACCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGTGGC
CAGCTCCCAGGATCGCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGTGAGAGTAAGGCTGCCCACTGTCCCTGTAAGCCGGTCGACTT
GAACAACCAAGCCAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTTAGATCCAACACGCGCAGGAGCGCGAGTATC
TCCTTCTCCACCGCTCCATAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTTGACGACAGACCCCCTCATGTTCTTGTACCAGAGCTG
CTGAGACTGCCCAGTCACTGGCATGAACTATCACCGTAGATTGGCGTTCCGGGTCGAAATGACGGAGGATAGGTGTGGTCGCGATTCTGTTCCTTAGCTC
CACGAACGCGTGTTGAGCTCGGATCCACCGAGATTCCGCCTCTTCTGAGCTCTGATCTGTCGTCTCTATCCTGATTGGATCCTCTTTCTTTTGGTCCCGG
GGCGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACTACTTGGATCCCTTCGTGGATCCGACATATTCAGGGCCAGAGCTTGTTGGATTTTGA
TCCGGACAGCCGAAGTGGCCATCGCAGCAAAATCCACCTATCTCAATTCATAGAGTACCGCAGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTA
ATTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGTGAGAAGGACAAGTCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCC
TTGGAGACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTCACCACACTGATAGAGAGGTTCCACTTAGTACACGCCCCCAGTAGGG
AGGTTACTCTCTCGCACAACTGATCCCACGATCCCAATGGGATTAAATTGTCGTCGATATAAGATCTGCGTCCTAACACAGACGGGGCCCAGGATCCCCT
GGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGATCTTCCCCGGATCCACCCTTCTCGGGTTCCGGTATCCGGGTGAGTCCATAGAGGGCATTATCGA
TCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAATGGCATCCGGTTCCACTCGAACAGTCCAAACGGTAAGATGAATGCGGATATCGCGCGAGC
CCGATCCGTCATAGTCACCACCCAGAAACCGCTGGCCATGTCTAGAGAACAGTACCAGAGTAC