Description :
From Genome Similarity Track
Location :
Scaffold_3:345351- 353351
Transcript NameFunction/comments
Physo_127881reverse transcriptase
Physo_127882hypothetical protein

Sequence
8000 bases(100 bases per row)
CCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCACCGTCACACTTAATAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACCTAAATCCG
CTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAACGACTCGCAGTACGAGTCCGTTCGTAAGATGGCAGGCATCTTTGGG
GCAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGCCCACGTTC
AAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAAAACCTTCA
CTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGGTCGCACT
AAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCTCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCCGGCGAACT
ACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTTCATCCAGGAGATGCGAGTGCTCACTGCCTCTTTGGT
GGGGAACCCCCTGCCTGAACATATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAGCAAACACT
ATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCCACGGTATGACAGAGCAACCCTGCCTCTGGCGGTG
TGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGGCTGTGGCAA
GCTTCGGCACATGAAACGTGCTTGTCCCGCGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCCGCGCCCC
AGGAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGACTTCATGAGGGGCGTGCGGGTGGCGCACGCCATGGGGA
CTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGGGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCCCTTGAGA
ATCTTGATGGACTCTGGGGCGTCCAACAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGGGACAAGTACGCCGATGCGCTACGAGGCAGCAAAGGCA
ACGGACTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACAGGGACCTCACTGGTAAGTTAGAGGACTTCGACAGCACGGA
GCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCAAGGCCATC
GGGTCCAGCCATCCCCCACGCTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGTAGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGGCGCAGCAG
CGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGG
TAACGTAGGTCTACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTAGGTAACCATGTTCCACGCGCG
GTCACTCAGACCGTAACTGATGAGGAAGGCACTGCAGGCGCTTCTGATGTGGGTAACATAGGCCCACAGGAGGTCACTCAGACCATAACTGATGCGGGAG
CCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGAA
CAAGGCGGGTAACCAAGTTCCGCTCAAGGACAAGGCGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGAC
GAAGATACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCG
TAGAGTGTTATCACATCTTCGACGGCGTGACCGGTCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCT
TGAGGAGCTCGCCATGGAGGACTACTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCG
TCCTCGGCCATTTACCAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCATCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGATCCGGTGTACC
CCTTGGTGAAGGAGTTTGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCAC
GAAGTACTGTGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGGGGAGT
CGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCTAACCGAACGGAATGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCC
TGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGATACTACCAGATC
CTGATGCGCGAGAGCGACATCCCACTCACGGCTGTGAGCACGCCGAGCGGTAAGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCCTTCTAACGCCCCGG
CAACGTTCAATCGCTTGGTCACACAACTGTTCCGACCTTTGCGTGCGTTCACACAGTCGTACTTTGACGGCATCTTCGTCCACAGCCGTGCCGAGGCAGG
CCAGACGGCCATGGAGGTGATCTCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCACAG
CTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGCCCGGGTGGTCCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTC
GCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTATATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCG
ACTGGCGCTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGTATTGCCGGACGAGACGAAGCCTTT
CAGCGTAGTCTGTGATGCGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGCCATCTCGTTCCAGTCCAGGCAG
CTCAAGGCAGCCGAACGGAACTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGACGC
CCTTTGTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACACCGCATCTCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGAATA
CAACTTCCGTGTCGAGTACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACG
ACGGATCTGTATGATCGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGGCCGCTGGCTCCGAAGCCAAGGCCGAGT
GGCTCACGCCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGTTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGT
GCCCAACGACTAGGATCTCAAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCG
CAGATGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTACCAGCGCGTGAGGCCTGCCGGTCACGCCTCGGCAC
CATTGCAGAGCCTGCTGGTCCCAGCGGGCTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTTGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGT
TGCCTTCGTGTGCCGTCTGAACAAGATGGTCCACATTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTGTGTCTTC
CGACACCACGGTTTGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCCCACGACTGT
CGATGTCGACGGCGGACCACCCGCAGACGGATGGCCAGACGGAGCGCGTCAATCGCGTGCTCGAAGACACGCTCTGCAGTATCGGTGCGGAGATGCCCCG
CTCTTGGGCTGATCGCTTGCCCATGGTTGAGTCCGCACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCCCTTTTACCTGAACGGGTTGCGCCAC
CCTCAGGTGCCACTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAACTCTCGGACGTGAGTC
CAGCCACCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGACAGTCTGAACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAA
GGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATATAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGC
TCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGCCCAAGTCGATGA
CGACTCACCCGACGTTTTACGTGGGTCGTGTTAAGAGGTATCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAG
CGCAGCTCCTCGAAGCGCGGCGTCGAGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCGTACATCGGAGCAGCATACGCAGGGG
CCCCGTACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGTGGTCATGAAGCTCGGCCCGAGCATGGTTTCG
CAGCGAGTCGTAAGACGACAGGTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATTCTCACGGAGCCGCTCC
ACGGCACCAGGCTGACCAGCACGAGCGGCAGCCTCGCCACCAAGACCGACACCAAGCGCGATCTCGAGGACGTACACACAGTCCCGGAGAAGACGAATCT
CCTCTTGCTGCAGGGCCACCACCTAACTCGGGGCCCCAGCATACGGCTGCGCCGCCTCAGACTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGCCCTCC
TTGATCGTAATGGGCAGATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATCGCAAGCGCCAGCTGCTCGTGAAGTGGAGGGGTTACCC
TGAGTCGGATAACTCGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAG
TCCTTGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCTCGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTC
GGTCATCTTCGGGCGGAGCATGCGCTAGCTCACGTATTGAGCGAACTCGATGCGGAGCTCGCGGGTCCAGGATAGCGGACAGAGTGCGATCCTCACGGAG
CTCTTTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCTCCAGGTCATGTTGTCATTCGGCTTGACCCAG
TGGAAACCCCACACAGGATGGAGTCCACCCTTGTCCTTCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACAC
ACCGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGG
AGCCGAGAGCTTCTCCAACAGCGCTGACGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATG
GCAGTCGTGGCAGTCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGT
GGACGGCACCCTCCTCGTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTC
GGCGGCCTTCGCAGCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTCGCTCGGCGACTTC
TCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCCGCATCCTTCTCTGACGAGG
CCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGA
ACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGC
GCGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTAACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGCCTTCGTGGCCTCCA
TCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCTTGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGG
AGGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGGGCCGATGCGCCAGAGCTCGCGCCGTT
GTCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGCCGGCGTAACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTAACGG
GGTTACATGGAATAGTGACCCTGTCACTATTCCGGGATGGCTACATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTCAGAGCCAACAGATACATTT
TGTATGACACAAACTATAGGGAACTTAAGAATTGTATGCAGGCCAAATCTGTACCAACCTATAAACACATTCAGTCTTAAATCTACCGCTTTTCAAGTCA
AGCCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACA