Description :
From Genome Similarity Track
Location :
Scaffold_9:345252- 347536
Transcript NameFunction/comments
g5564.t1hypothetical protein
g5565.t1OWZ24477.1 Protein phosphatase 2C [Phytophthora megakarya

Sequence
2284 bases(100 bases per row)
CGGGTATGTTCGATGTGTTCTTTTGTGTAGCTTATCACCACTTCCTAACTCTAGTATTGACATTCATGCAGTTTTACACCGACACACTGGAGAAGAACTA
CGACATGTATAGGCAGCAGCTAGACAAGGAAAGGAACGTCAACACTGCATTATCTAGCGTCTCGACGGCCCCTCTCTCAGTCGCAACGAGCCCGCCGCAA
ACTACCAGTAGAAATACTGTTATATCTCCTCGCAACGCACACAATTCGAGTTAGAAACCATCGTAAAGAGGGGCAAACCCTTCACTTTGATTCTTGAGCT
TTTGGATGCTCGCGTATTTTGCATTTTCCTCCGTGTAGCTAGCTGTACATAAGGCTGCTTGGCAAGACACAGCCTCAATTCACTCTAGTCGAAGAAGAGG
ACAACCACCGTCGTGTCATCGTGACGACGGCGACGGTGGCTTCCTGGGGGCAAGCTCAGCAGCTCCTGGTACGTCATACCATAGCGCTTCGCTGCCTTTT
GAAGCACTCGCTCGACCAGCGCACGACCAGCGAGGTCGTGGTTTCCGCACGAGGCTTGGCCCTTCACCACTTCCACAGCCTCCTCGTTGCTCAAGTAATC
CCACAGTCCATCAGAGCCGATGATGAGGAATTTGTCTCCCTCCTCGAGTTTGTGTGACTTGACCTCGGGGGTGGCCGTGATGTACGGTGGCGTGTAAGGA
GCTGAGAAGTGACGTCCAGCAGAGCGATCGCCGTTCACGTAGGGCGGGCCGTTGAACTCTGGGTGCTTGAGCGAGAAGTCACCAAACGCACGGGTGGGCT
GCAGGGCGCCCTTCACGTAACATGAATCCGGGTGGCGACACGTGAACACGTTCGCCTCCCCCGGGTGCTCCTTGGTCAACTTCTCCTGTTCAAACTTCAC
CATCGCGTTCTGGTCGCTGCTGAGGGGTTCCGCCACAATAGTGTCTGCATCCTTGCCCAGTTTCCCCAGCACGGCGCGGATGTCACCAGCGTTAGCAACG
TGAACGGTGCCTTCGTGCACGTACGCAAGGCACGCGCACGAACCGCAGCGTGCCACAGCTCCGAAACCCAACTTGAACGCCGACGCCACCTCAGCCAGAA
GGTCGCGGTCCGTACGTCCAAATGCACGCTGGATAGCAGCAGCTACGCGACCGTCTGGGACGGTCTTCTCGTCTCCATGAGCGGGCTCGTTCGTCCCCGA
CTTGTACAGGTACGACAGCTCCTTCTGCACGTTGCCGATTAGCGTCTTCCTGGCGTACTCCGACACCTGCCAGCCACCTGCCAGTTGCCACCGAAGCACG
ATTAGAGAGCTCCGAAACATGCACAGAAAGGCTCCAAGAACTGATGCTGTACCGTGGCCATCCAGCACAGCCGCAAACACGTCGCCCGAGTCCGTCGCCT
CGACCGCGTACTTGTCCTCAATGGGGAAGTTGGCCTTGTACGACGCGCTGCTGAGGCGCGTGGCGCGCGACTTGGCGATGGACGCGAATTCCTCGCGCTC
GAGCGGCACGGAGAAGGCGCCGTCCACTTCGGGCGGGGCGTATCTGGCGTCGCATTGCGCCTCCAAGTGCGCTCCGCTCACGTCCGCGTTGGCCAAGGCC
AGCACCGACAGCCCCAAGCCGCTCAGCAGCAGCGCCTGGCGCAGCGTCGAGCCACGATACTGCAAGCAAGAAAAGTCAGTGTTGCGAATGGAAGATTCTA
CAGCGTGTACGCTCGCAAAATTAATGGGGAAGAATTGGTTGAAGAAGAGAGGAAAGTAGACAGGGGTAGAGCGCTTCCTACCTTGGGGCTCTGTCGGCTG
GTCAAGCGCGCCAGGTTCCGCGCCGCAAAAAGTCGCATGCTTGACGTCAGTCTTGATGGTTTATGAAAAGGGGGATCTGGGGTGGCTATGGTGTAATTTA
TCGTTTTTGGTCGTGTAGTTGACGTTGAAGCGAGGCATGACCAACATGTTTGCGGTTGCGCTTTCGTGTCAAAACGAAGCAAACAAATGCATCTACCGGT
GGATGAAGAGCTGGGACTTGCGGCAGAATTCCTGGCAGTTGTGCAACCAGTCGTAGATATTAAGCTCTGCAAATGTTACTGATGCTGTGGTCGTGAGAGC
TGCCAGAGTCCAATGTAGCAGGCGTCGACGCTCGGGGTCATCACCGTCGAGTGTGCAGTGGTCGAGTTGGACGCAGTCCACTTAACGAAACGTGTTGGGC
AAAGCGCTGTCCACAGAAGATCGGTATTATGGGAAGCGCTGACGACCATGCGGGCGTTACGCGGCGGCGCCGACCCAGGCTTGA