Description :
From Genome Similarity Track
Location :
scaffold_60:34524- 35625
Sequence
1101 bases(100 bases per row)
CGCTAAGCGAGTGCGGAGTCGTTACAATCTTCATCACAGATGAAAATGATAGACCAGCAACAATTTCACCTCATACATGCCGGCTGGACGAGTATTCATA
CAATTTGAATGACAAACAGCTTGGTCAATTGGTCGGTGCAGTGGTATGCAGCCTTTCCATAACAGATGAAGACAATAGCGGGTCATCTAATGTTTCGTGG
AAAACTCACGATTGGAGCGTGGTGGGGTCTGATTCGGGATGTCCGTTTACCATTAGCTCTCACGGTCAAGTTTTGGTGAGATTTCCCCATCTTGTTGATT
ATGAAGAACGTAAAATGTGGTCGATCCAGGTACAAGCAACAGATTTTGGAGGGCTGTCAAGCCCTCCGCAAAGGATTGACATCGTTATAGATGATATCAA
CGAAGATCCGCAGATGACCCCTAGCACATTTTACATCGATGAGAACTCACTGCCTAGTACCCAAGCATTGGGAGACTTCATGATTGTAGATCCAGATATA
CGCAGCGATGGTCAGCCCGATACTGTCGTTGTCACGTTGGTTGATAAGGTTGACTTTTTTGAAGTTGTACAGAACAAAGTTCGATTGGTGCGTGGTGGGC
TAGATTTCGAAGTGAAGCCATCGTATACCCTCTATGTTGTGGCGACAGACGCATCTGGGGCAAGAAGCAGCCTTCAGAGCGTCAATATTGTGATCAACGA
TGTTAACGAAGTCCCATCGATTGACACAGTGCGAGTTTCCCTATCTGAAAACCAACCTATAGGAACGAAGATCTTCCCAGCCGTTTCGGCAAATGATCCT
GACGGGCTTAGTGTCTTTTTCAGTGTGGTTTCTGAGAACCCAAGTGGTGGTGGTGGTGTGCGAGCTCCAAGTACATTTGAAATTGACAGAAAAACTGGCG
TTCTGTTCCAAAACGTGGACAAACTGGACTACGAAGGAATAAACGAGTACGATTTGGTTGTGAAGGCACAAGATAGTGCCGGTCTGTTTTCGACTGCAAT
TATCACAGTAAGAATTACTGATATCAACGAACCACCTCGATTGAGCGATCAGATTGTAAGTATCCGAGAAGATGCAAGGGTTGGATCTCTTGTCGGCCAG
G