Description :
From Genome Similarity Track
Location :
Scaffold_70:34522- 37132
Transcript NameFunction/comments
Phyci_82411hypothetical protein

Sequence
2610 bases(100 bases per row)
ATGGAGGACTCGGTGGCGTGGGCGTGGGCGCGGGACGCCGCGCGGCGGCTGCGCCAGCACTTCGCGAGCGAGCGCTCGGTGTCGCTGTACGAGGCGCTGA
CGGCGCACGCGCTGGACGCGGCCACGGGCGGCGCGCTGTTCCTGGGCGGCGTCTCGGCGGCGCAGGCGGCACAGAAGCTGCTGCGCGTGGGCTCGGCCAG
CGGCTTCCTGCTGCCCCAGGCGCTGGGCGCCGCCGCCGTGGGCGCGTCCTCCGTGGCGGCGCTGCACTTCGCCTCCGTGCCGCGCGAGGTGTACCAGGAG
CTGGCGGCGCGGAGCCGCGAGCAGCAGCGGCGCGGCTGGAGCTGGCTCGTGCTCGGCGCGCAGAACCTGCAGCCGCCCACGGCCTGGCGCCTGCTGCGCG
GCAAGGCGCACGAGCGCTGGGAGGACCTCGCGCAGGCGCCGCTGCCGGTGTACGCGGTCATGGGGCTGCTGTGCTTCACGCTGCTGGGCGGCCGCACCAG
CGCGCTGGCACCCTCGCCCTTCGCCGACCTGGGCGCGTTCCACCTCCGGAAGGCCTCGCTGCCGGCCACGGCCGAGTACGCCACCGGCGTGGAGCGGGGC
ATCATCCAGGAGTTCGGCCGGCTCTTCGGCTGCCACACGTGCGGCGTCAAGCGCGGCGTGCGCTACCACGCAGACCACCAGCCGCCCAAACTGTACGCGG
CGGCAGTAGCAGAGGCTGCCTGCCTGCCTGAACTGTAGCTGTCGTTGTCGTGCCTTGTTCTCTGACGCTGTTGCTGTTGCTGTCTTTGATGGGGGTGCAG
GGTCGCGAAGCGCGCGGACGAACAGCTCTTCCGGAAGATGCTGGGCCGGAAGACGACCTTCCGCTTCTACCCGCAGTGCGAGTCGTGCTCCAACCAGCAG
GGCAGCGTCGTGAAGCAGTGGAAGTCGACGCTGAAGATGCACCTGCTGTCCTTCCGGGCCTACCACGCGACGGGTCTGTGGCTCGTGCTGCTGTGCACCG
GCGGCCTCTACGTGGGGGGCTCCAACTTTCACGAGACATCGGAGGTGGCCGCTCCGATGGATGATGCCACCGACACCACCGGGGCATTCACGTCGTCAGA
CTTCTCGCTGCTGCTCTCGTTGAGGGAGCGGGAGCGCAAGCTGCGTCGTGAGCGGGGCAAGCTGAGCGAGCCGACTCAGATCGCTGCGATCGACAAAGAG
CTGGAGGCCGTAGCGGAGTGCAAGGCGGCCGTCAAAGCCAACATCAAGCGGCAGAAGGCTAATTAGCCAGCGCGCCATTAACGTCACTAACACGCAACCA
GTTTTGAACAGCACGCCCTGCAAGAGGCCGATTGACCAGGAGTTTCGCCTCGAGCTATTTCCGTTGAAGTGCTGGGACCGACTGCCGCTCGGCCTCGCCA
CAGCTCGAAGCGAAAGGGCCATGGCGACGGCCAAGCGCGAATCGGTCGTGAAGAACTTCCTCGACCAGCGGCACCCGAGGAAAATTGGGGCTCGTAAGCC
GAGCCATCCCCTGCGAGGCCACCGCCACCTTGTCACGCTTTCGGAAGAGGAGCTATCTCGGCGCGAGCAGGGGTGGAATGACCGCTTCGCCGTCGACCCG
CCGCCTAAATCCAATAAGGCGCCATCACCAGTACATTCTCCCACTTACAGCACGCCACCAACGCCGCTGACGAAAGAGTCCAAGATTCGCAACGAGCGCG
TGCAATATGGTACGGTTGACGCTACTTCGGTTTGTCTTTGGCGTCACTAATGACTCGGTTGTCGCCAGGTAAGCGTGGCGGGAAGCGCATACGTGAGCCA
AAAAAGCCGTCAAGCGGGAAGCTGATGCCTCTGGGCACTCTAACCAAGCCTCCTTCTGTAAGTCACATTGGCTGTGTCTTGATTCAGCGCTGTTAATGAC
AACATTTGATTCTGTGCATGCTCAAAACAGGAGTCTGCACAGCCTACGAAGGAGGAGAAACTGCGTTTCAAGGTCTTGAAAGCGATTGATGCTCGCGAGA
CCCTGCTGTACCAGTTGAGTGCGCTGATACTTTGCACACCCGTGCAAGAGTCACTGTTTCTCCCGTCTCGGCCAACTGAGCCTCCGACGTCAACCAGTGC
AGGGCGGCAACAGATGCGATCGAGGGGAGGAATGGCACTCGCATCAACGCCCCTGAGCCGTCACGGAGGAAATCCAGGAGCAATGACAAACGCACGCGAG
GCTACGAAGCTGGCTCAACAGCTTGCCACAGATTTACAAGTTGCCGGAATCCAATGTGTAGAAGGGTTAGTTGAATGGATGCTAGAGGCTGGAGCGCAGG
CAGAGTACGTACTGCTGGACATTGTTGTTTCCTGTATGAGACGATACTTACTTATTTGCCTCTATATCTCAGAACGCCTCCTCCATTCTTGTGGCGCGGT
CGAAACTACTTTCTGAAGATGATTAGCGATTTAGACTTTGCCGAAGCGGAGTTGCAAGCCAGAGGGGTCAACTTGGACTGCTTCAAGAAAATGAATCCCC
TCCTCATTAAACCGAACCAAAAGTTGGGCCGCGTTCTGGCTGCCCACTCCATCATCATGGAAATGGTTGAGTTCGCAAAAGATATGACTCCGATGGAGCT
CCTTGCCCTC