Description :
From Genome Similarity Track
Location :
scaffold_418:3452- 6001
Transcript NameFunction/comments
Pl_105042hypothetical protein PHYSODRAFT_507209

Sequence
2549 bases(100 bases per row)
CGTTTTTGCTTCGACTAGCTCAACAACGGGTATCGTACACTACAGATTCGAAACCTGACCAGGTTGCAGTGAGTCAAGGCGTCTGAGGACCTTGAGGTGG
CTGCCGAAAGGAGCTTTGAATGCAACTAAACCAGCTCGTTTACAAACTCCAATGGTTCAAATTTGAGCAAGGTCCACACTCTCAGCCTCGTCTTGCGTGC
TCTAGCCTTGCAGCTGGTGTCTGTAAGCCTCAGGTCGTGCTCGAAGGCCCCGCAAGCTGGTGTAGAGTCCGTGAGTTCGTATAGATACGCGTCTTAGACC
GTTAAACTAGTGTGGTATGTCTGAAAAGTATGAGGAATGCTCTCCCGACTGGAATTGCTTGCACCGTCACTCGTGTGGGTCTCTCTTTCGTCTGCTGCCT
GCACATCTTGTACCTGGGACACATCGGCAGTCTGTCAACTCCCACTGACGTCAACGTCGAAGTACCAGTTCCCAATCCCCAATCTACCGGATCGGAGACT
TTCGTGGAATTCGACCCCCCCTCAAGTGTCGACCCCCCCTCAAGTATTGTGGTGCAGTGCATGCAACCAGTTAGTTCAAGCTCCGATTCGACTCTCAGTT
GTGTCTCTGTCATCATGCAATCGTGTCATTCGGATTCCGGGGCTTCCGCTGCTAGCGTGAAATTCCCGCTTGCAAAAGATCATTTCGGAGAAGTGAACGT
CTCCATCGAACAAACGGAAGAGTACCGAGCACTAGTACGTCGAAGAATCGACGGGTTACTTGCTGATGAAGAACTCTACGCTTCACGGAAAGCAGGGCAT
CAACCGCGACTAGATCCGACCGAATGGAAGTGTGTTCGATCTCAAGATGAAGTGAAAATGTATAGACGACGGAGACGAGCGCCGACACAAAACAACGAGC
GTGTGCCAACCGGTAGCATCCTTGCATTGGGCAGAGTGCCTGGTTCGATGGAAGATTTATTGTACGGCACCTTCAGTACAACTCAAGATGAAACACAGAC
GACTATGGCGTACATGCACGAGCCTACGGATTGCGCACTACTACGAGTGTTGGAATTGGATGCACCCGATGATCCTTTGCATTTTCTAGGACTCAAGTGG
GTTCTCAAGAAGATGCCAATGCAAGCAATTGTCACGCCCCGCGATGCGTGTTATCTAGAGGCAATGGGAATACAACAAGATGTCAAGAACCACCAATTCG
GCTATATTGTACTGCACTCTGTGGACATCCTGCAGTGTCCTCCGTTCGACCGCAGGAGGAACGATGTGATCCGTGGTGAAGTGTTTTTTGTGGGACTATT
CCGTGAAACCACGCCAGGCTTCGTGGATGTCATGGTGCAAGGCATCTTCGACTTGTCCGGGGATCTGCCAAGACACGCGGTGCCACTGGCGTCCATGTCG
TTCATCGGCGGCATCCTCAAAGGCGTGGAGTGCGCGGAAGCAAAGAAGCTGACGTTGTTGTCTCGACACAACTCCGTGTCTGGTTACAATCTGGACGCAG
TGAACCAGGATGAATCCTTCGCCAAGGACGCCGTGTGCTCCGTCTGTATCAAACGTAGCAAACGCTTGTTCTCGTCTACTCGTCTTCGTGCGTGCCGTGT
CTGTGGCGTGGCGATCTGCTCCAAGTGCTCAGCGAAAAACAAACGCTTGTTTCTCGGATCGGAACGACCGTGTGCGTTTGCTGTGTGTTGTCCGAACTGT
GTGCTTGATGCGCAACAAATGACCGGAATACGGCCGTGCGAACCTGAATACGCTGTGGTTGCCGACTTTTATCTCCACCGACCGGCACTTGAGTCGTACT
CGGGTGCGCTCGATGCTGCTGTGGCTCAGCAGTATCTGGTCTCACTTAGTGCTTCCGAGATTGATGAAAGTGAGTGGTGGGGTGACGGCGATGAGATGAC
GGACACGGGATCAGTGCCCGACGTAGTTCGAGAGGAATCAACCTCAGGTGAACGCCCCACGGACGCAACGCTGGACGAGAGCTGGGTCGGTCGCGACTTC
ATGGACGGCTACGCCTCCACTCTGAGCGACATGAACGGGTTCAACTCCAGCGCTGAAGAAGACGACGACTGTGCTCTCGACGTCGAAGCCGTTGAACATT
GGCGCGAACCTCCATACGAAGAGGAGATCGACGTGAGTGCCAAGTCGACATCGGACGCCCTCGCTGCATTATTAAAGCGAGCAGCCTCCATCGGTAGTCA
AGTGCAACAGAATGACTCGGTCATGCGAGAAATGCAGCGAACAAGAGTACAGTCGAGATATCCCTAGTCTAAAGCTTCACCTTCACGATCGCCGTAATGG
ATCCGATCTGCTGTCCCTTCTCGAGGTACAGCCTTGCGTTGGGACTGTCGTCACCTCCTGATCACCGTTAGAAGCGCAACTTGACCATCATCTTGAAGCT
GTAGCTTGGATTGGTCTCGTCGATCCAGCTTGTCAAGCGTGGCATTGCTGACACATTCACGTCAGTAGGTCTCTGTTGCAGAGGTCTAGTGCGAACGACT
GGACGAGCGAAAGGCATGCAGTTCCTTGCTCACTCGGCATCTTACCATG