Description :
From Genome Similarity Track
Location :
Scaffold_1760:3452- 5172
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1760-snap-gene-0.3Pinin

Sequence
1720 bases(100 bases per row)
CGCTGAACCACAAGGATCTGTGGACAATGACGAGGTTGTCGTGGCTAATGATGCTGACAAGGAGACCGATGACAAGGAGCAGAATCCGGAAGGCAAGGAA
GAGCAGGGAGTTGAAAAGAATGAGAAGACAGTTGAAGACACCAAACCCGATGTTTCAATTAAGACAGACGACAGTGAGAAAGCTGAGGTTGCAGCGGATT
CTGTTGAAGAGAATGCTATGACGGATGAGAAGACTGAAGTCAAGAAAAAGGAACCATCAACTGAAGCTATTGAAGCCGAAGCAGTGGCGAAAGAAGAACC
AATGGAGGCAACAGCTTCTCCAGCTCCAGCCGTCCCAAAGAAGCTAAAGGTCGACATGAGTACTCTCAAAGTGACGGAGCTCCGCGAAGAGCTTAAGAAG
CGTGGACTCGACGCGAAAGGACTGAAGGCGAGCCTCGTTGTGCGTCTTGAAGAAGCCATGGAGCAAGAAGAAGCCGCGTAGAAGCTGGGGCGCGAGACGA
ACCGAGGGGACACAGCAAACAGCGAGCAGAATCAGCCGGTGTCTTGACGCACATGTAGGAAAGCCAACACTTCTTGCTTTCTTTCTAGCTGGTACGGATA
TGAATCGCCCCTTTTGCTATTTATCACCAGTGATAGTTTTGTTGGTGTTGGTGTGACAGACCCTTCGAGTTCCGCCTGCCGCTTTGTTAAACATGTTTGG
GTTGTTGAGAACCCAGCTATGCAGCAGTAGTGCAGCCATCCCATACTGATGCAGTACAACGAAGCGAACAAACCGGGACCAACAATGGACGCAATCCGTC
CAAGATCGCGACGAGCGTGGTCATCATCCGATGATCTGCTGAAGCAACCAACCATGTGTGCCATTGTGGACGCTTGATGATGCTGAGCAACGAGTTCGTG
AGCGTAGCGTCAGCTCTTCAAGATGAACTAAGTAGGTACGAGTTTGAATTTGAAGGAGCCCCTGAGCGATAGCCAATGTAGACGAAAATGTTTGAGCTGA
GTGCTTCATGGAGTCGCCAGCAGACTTTGGCACGCCGTTGAAGTTCTTTTTCGCCAGCGATCGCCATCATTCTGCCAATAGAAGGGTCTGCTGTTCCTAT
ACGCTATTTAAGGCAATTCAAACTTAATCAGGAATGTTTGCGGATTTTATGAAGTTTCAGTGTTTTACAGCTGGCACCAAACGCGGTTTTAATCGAAACA
TCTCGGTACTGTACAGTCGTACTGAGAAGTTTCGATTATTATATCCACTACTGTCGTGGACTCGACGTTCGCATTCACTCTTATCAGGCAGTCAGTATTC
AAATACGGCATTTGCAGCAACACCGAGAGCTCAAGTCACCAGTCGCGTCGATGGCCACAGCTCCTCGTGCGCATGGCGGTGGCGGTGGCGGCGGCGGCAT
GTGCGCCACCGCGTTCGGAGGCGCTGCGGCTGCTAGTAAAGAAGAGTGCTTGTATAGCGACGATCTGGCGATGACGCATGCGTTCGTCGCCGAGTGGGGG
TGCGACTACGACGGCGATGACGAGCAGGAGCTCCATGGTAATAGCACACGCTTTCTGAGCGCGGCTGGATCTACTGAAAGCGACGCATATATTGCGAGAC
TGGATCACGTACAGCAGCATGATATCACGCAGTTGTCCACTGATGAGCGCGTGCAGCGATCGCCTACTGATGTGGGTTACAACCAGGAGGGTGTCTCGGA
CGTGAGTCCCGTGAAGAAAG