Description :
From Genome Similarity Track
Location :
Scaffold_118:34513- 39356
Transcript NameFunction/comments
Hyaar_Emoy2810106PREDICTED: dynamin-1-like
Hyaar_Emoy2810107flagellar adenylate kinase
Hyaar_Emoy2810108Vtype proton ATPase subunit H putative
Hyaar_Emoy2810109hypothetical protein

Sequence
4843 bases(100 bases per row)
CAGGTTGTCAAAGTTGCGCGGGAACCCGTCAATGAGGAACAGGTCGCGGCCGCTCTTGACCATCGCCTGCTGCAACAGACTGAGCGTGATCTTCACCGGC
ACGATCTGACCTTCTTTGATCATGTTGTCGATGAGTTGACCATTGACAGAGCCCGACTGACGCTCTTCACGTAGCAGATCACCAGCCTAGAAGTACGAGA
CAAGTACAATCGGGACACGTCACGTCAGTCTTTTTCGTATAAGTATACCATCCTCTTAGCACGTCACGACAGAGGAAGGAATGAGGACAGCTACAACTAA
GTAGCAGCAACATATCATATCCCTTTTTAATAGTGCCTACCGATAAGTGGACAAAGCCAAACTTCTCCACGAGCTTCGTGCACTGCGTGCCTTTGCCGGC
GCCAGGACCACCTAGTACGAACAGGATCTTCTTGGTCAACATTTGGTTTGGAAAAATGACCTGCGGACAAGTTTTTGTGTACAAGTGTCCGTACACTTTT
GTCAACGCCTACACTAGGATCATGGTCGAAACTGACCGACCGACCGACAGACCTTCCAAATTTAATGTATAGTCCCTACCTTCGTGTCACTTCGACATGA
AAGCAGAGCCGCGGAAGGATCGCTTCAAGCAGCCGCACAAAGCCGCCAGCGCCATGGACACTGCGCACCACGTGGTGATCGACATGTCAGGAAGTGCCTC
GTTGGATGTGGCACTCGCTCGTGAAGAGGCGCTGACACGTTTCCGAGACATTAATTGGGCGACGTACACGCGGTACGAACCTATTGAGTTGCGTGGAGGA
ATCCTGTATCAATAAATAGAATCTTTAAATTTATATGCCGCCTTGTACTTGCTATTTTTGCATCGGTGTTTCGGTTTGGACCAGTGCGGGCGGGTTTAGC
CTAGAGAAGACGGAGATTGCTGCACTAAAAGACCTGGAAAAAGTGATCAAGTCCAGTCCTGAGGAGGCCGTGAACGTGAGGACCGAAAACTGGGATCAAA
TACGGGACTCTCATCTTTAATATGCACTTGTACTCACTTATTGCATCTTTTCGTCACCTGCTTGTGTTAGGCTCATGCTGTAGACGAGTTCATGAGTGGT
ACAGACTCTGCACACACGTTGTTTCATGCTTGTTGAAGTCTCATTGTTTTTGCTTGGATTGATGATATTGTAGCTGCTGGCTCTTCGGTGGGCAGCGCTC
TGCTTAAATTAATCAAGAATGTGACGGACCCTACAGTTCTCAAGTACTGTCTCGCTCGCATGGAGGAACTGCTGCCGGGTAAAAAAAGCGAGAACTAGTT
GTGAAGCTATGTCATGGATTCTTACTGGACTCCTTGTGTTGTTTGCTGGTTATGATAGATGGACTGCGTCTGCGTAAGCGGATGGTGTACTTTGTGCCAG
AAGGCAGTACTGTGGATGCAGCACCATTCTTTAGGATGATACGCAATGACACGGGCTATATGCAGTTTGCTGCTAGCCACTTGCTTGCCCTGTTTCTTAC
GTACGTGATACAAGATGATTGGGTGGTATCAGTGAGGCTATATTGGTTAGATGTATGGCGTGCGTGTATGTCGATCATTTCCAGAATCCGGCCAAGGCAG
GACGATGCCGAAGTTCTGAGCCAGTGGGCGATTCAAGCTTTCACGGCGGGCTCGTTGCAGGCCTCAACAAACGACCCGAACCGCGCAAACATTACCCGTG
CTGCAGCTGCGTCCTTGATGGTGCTACTGCGTAATGAGTCGCTGCGAGTGCTTTTCGTTAAACTAGGGGGCGTGGCTACGTAGGTTGTATTGTTTTTTTG
TTGACATGACCGCATGTTCACTCCTGTCTTGTGTCGTGCCAATAGCGTGGTGAACTTACTGGAGTGCTCCCAGAACCGCGCACAACTTGCGTATGAGGTA
CGCTCTACAGCAGACAGATTGTGGCTTATTTGAAACGATGCTGAGAATGGTGTCGATCTCGTGCAATTTGTTGCAGCTTACCTTCATTCTGTGGACCTTG
GCATTCTGCGATGAAGCTTTGGAAAAGTTTGCGGCTGCCAATGCGTTGGACGCGATCGTACTTCAAGTGGCGGCAGCCCCGCGTGAGAAAGTCGTGCGTG
TTGCTCTAGAAGCTCTTCAGGTGAGAGAACAGAGTCGTGCTATTGCAATCCGTTGATGTTACTGATCGGTGTTTCGATCCCACGCAGAACTTACTTGGCA
AGCTGTGTGGCTTCTTTAACGAACGCATGATTGAGAGCGGGCTTATGAAAACCTTGAACAACATGCGCGAACGAAAGTGGGCCGATGAAGATATTGTGAA
GGGCATCCAAGCTGTCCGCGACGTGCTCATTCGCGAGTACAAAGAATTGAAGTGAGACGACAACTTTACCTGATCAATGTTTCTATGCTGAGCAATGAGA
CTGATTGCCGCGATAACTAATGTGTATCGCGATGTACGTTGTGTCTAGTACTATGGAGCGATACGAAAAAGAACTACGAACGGGAACACTAAACTGGGGG
CTCCTGCACACAGACAAGTTTTGGAAGGATAACTTCATGACGTTTGAGAAGAAGGAATTTGAACTCATCCGGTAAGCGACAGGATCACGTGGAATGGTGT
TTGGCTTTCGTTTTATTTCGGCTACTAACGCTGGATCCGACTGCAGGTTGTTGATCGACTTGCTGGAATCGGACAAGCCCAGGACCGTGGCTGTGGCCCT
TTTCGATGTGGGCGAGTTTGTGCGCTTCTACCCGAATGGCAAACACATTGCCAAGCGACTTGGAGCGAAGAGGGTGGCAATGAAGCTTATGACGCACGAA
AATGGCGAAGTGCAGAAACATGCCCTGCAGTGCATCTCGAAGATGATGGTCAACAAGTGGGAGTTTGTCAAGTAAGCAGGCAGCAGATTAGCAGACTTGC
TGCTTTGTTACCCGGTTTTATTTTTACGAGTGGAGCGCCGCAACGTGTGTTGAGGACGGCTGAGTGCAGTCAAGGATTCAGCAAAAGCCCACGTAGGTAT
GCAATCAATACTTGTCTAACTGCTTCAATGACATGCAAGGTTCAGCAGTATCGTCCATTGTCGTGTATTGACACTATTAGCAGTTCTACCAATGAGGCAT
TTGACACCATCTTCAATGAATGCACTTGCTGCTGTGGCCAAGTACAGACAAACCACAGCAGGTCTGTCGTGGCTCCTCAACGAGTAGTGACTTGGTCGTT
GCTCGTGTCGTCTTCACACTACATTATTCAGCTTTTGTCCACGCGCGCCAGAGACCGATGGCAGCTTCCGCCGCGCATAGGAAACTCACCAGGCGGTCTG
AAGCAAATGTAAAAATACAGTTAGTTTATGCACACGTGCCTGCTGTCAAGTATCTATTAATAGCAGTACATTTGCGCACATACCTGAGAGAATTTTTTTC
TCAAAAGACCACTGAATGCACGGCCCAACATACAAAAGGTTGCGCAGTTGCACATAATTTAGTTCGCGACACCTGCAGTCGCAGCAGTTACCGTTGACCT
AAAATTAAGCGACTGGAAACAATATAAATAGAGCCACAGTCCGAAACATACCGATCTCGGATACACGAGAGGAGCGTTGAGCGCTACAAAGCATCAAAGA
GAGAGAGAGAGATAAATATAGAAAAATCAATCACATTTTGATTAGTAAAGAATAGATCACCACTACCTCAGTCACTAACAGCGATATTCATCACCTCATC
ATCCGTAAGATCTTTTCTGGCCCGGATCTGCTTTTTCTTTGCCTTCAGTGCTCGAATCCTACCACAAAATGGTAACAATAATACACACCAACAGCCTCAC
TATGAATTATCCTGTCGAATTAAATCCTCACAACAAATATCCATTACTTGAACGTACCGAAGTGCACTCGCATAAATATCCAAAAGAACGTAAACGCCCC
ACGCTCGACACGAGAGCCGAGAGAAATGCATCGCGTCGACTTTCAGCAGTTTAGGCGCGCTACATTACACGCACCAAGTATCCGAGATAAAATCATGATA
AACGATCAGTTTTTCCCGGATCCCGACCGTCCGACCAAATAGTATCCGACTTTTCCTTTATCCAGGATTTAATTTTATCTATACAAAATACCCACACAAA
TCCCACATATGAAACGTGCTCGAGCGGGTGATAGACGACCATAGACAGCGCCTGCAGCCGCACGAGGCGCTGCACGTGCTCGTCATCGTCTTTGCAGCTC
CATGAACCCTTTTTCAACGCCGTATACGCCTCCAAGCCGCCAGTAAAGCGCAGGACGTAGCGCGCCATCGAGATATTCGAGGCCAGCGCGTGTATATTCT
GAGCCGTCTCCTGCTGCGCTGTGGGCGCGAAGAAATACGCAGCGGCATCCAGTCCATACGCTAGTGTCTTGTACAGCTTATCAGCACCTATCGAGCTACT
GCTGAAGCGCACGAGCTTGTCGACGTCGAGAAGTGCTGTCATGACTATTTCGGATGAAATTTGATCGTCTCGGCTTCTGTTTAACTGCTATCGTGTCTTT
CCGACACGATAGCAGTTTTGACAGGGCCGGGAAACACAGCTTATGCGGTGTAGCGATATAGTCCCGGTACTGTTTTGACACACGTACGAATTATCTCGAT
ATACCGAGACGTTGGATTAATAGAAAGATAAATAGACGAACACGGTGCACCACGCTACTGGCTTCCTGCCTCACGATAGCCGTTACAAACGGGACGGGCA
AATCGCATCGTGACGCCAGTCCGTCACTTGCAAATTGTATACCCTCCACCAGCTGCTGCCTCACGGTCGTCCGATCGTGTCGCAGCGGCCCCCGCATGTT
CGTCTTCGTCCTTCGTGCCAGTATCGAAACTGGTCGACGGAAA