Description :
From Genome Similarity Track
Location :
Scaffold_156:3451- 9086
Sequence
5635 bases(100 bases per row)
CTTCCTCTGACTTTAGGAGCTGTGCAGCTCCGCTACACTTGGTAGCACTTGTAGTCAATTTAAGCCTGAGTCTTTAAAGACTGATCCTCTGTGAGGATGG
AAAATCCCACTCCCCTCTCTGAGGCCCAAAAGGTCGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGAGTATGTGGAATTACTTGTATCGCAAGGCCC
GGAAGTGCTGACTGCACGTGTTGAGGGCTTCTTGCAGTATGAAGCGTCCCTTCTAGGGCAGGTCCAAGACCAATTTTGGCGTCGGCTATGCCTACACGCT
ATGTGTCTGTTCCAGACGAAGAGGCTAGGCCTCGTCCACTTAGAGTGGAAGTAATTACTACTCAGGAAAGGAGGGCGAAAACCTCATCCTCTGGATCCGT
GAGATTGAGATGGCCATGAGATCAGGCCGGATCAATCTTGAACATCAACAGGTCTTTCTGGCTATCTCAAAGCTCGATGGAAGAGCTAGAGAATGGGTCT
TGACGTGTAGCACGTCGGTCGACTTAGCTTTTCCCACATGGGAGTCGCTTAAGTCACAATTGGTACAGGTGTTTTTACCACCTAACCAGGCTTACCACGT
GCGTTCAAGCTTTTTATCAACCCGTCAGGGTAGGAATGAGTTAACGGACTATGTACAAGAGCTGAGAACTCTCATGGCTGCTATGCAGTCTGACCCTCTG
CCTGAAGCAGTCCATGTGACTATATTTATGGAGGGTCTCCTTACTGGCGTTGCCAGAACCGAAGTCTTTCGGGTTCACCCCTCTACATTCGAAGTGGCTG
TGAGAATTGCTATTAATGCTGAGCATAACTTCAAGTTGGACAGACTTGGCTGGAATGGGTACAACCCTAGCTCTGCGAGAGCAAACTACATGAGTACTCC
GGCCGGTAATAGGACGGAACCGATGGATCTCAGCTATACTGAAGATGAAGGTGAAGCTGAACTTCAAGCTGCTGAGCAGCAACGTGTTGTACGACGTTGT
TATACGTGCGGAAGCACTAAACACTTACGTCCTGGTTGCCCTTTGCGTAAACAGCGCCAGGCTACGAGTCAACACTCTACCCCGAGCCAGAAGTCTGGCA
TGGCACGGGGAAATGCCGACACCCAGTAGGCGCGGGACGCCCTACTGGGGAAGAACTAGGTTTCTTAACACCTTTAGGAGGTAAAGTTGAACAGGGCTTA
GCCCCAAGCGTTCCATACCTACTGGTATCGAGCGTGGATACAAGTCTGGCGTGTTGGTCGCTGAGGCGAAAGTTAAAGGCTTTGAAAAGCCTTGGTCAAT
TTTAATCGATTCTGGGGCGTCTTTCAATTATGCTCGACAACGTTCCCTTGAGGGAAGTCAGCTTTATGCCGAAGCGCTTACAGCGCATGAGGGTGATTCA
ATCACGGTTTGCTTAGCGACTGGAAGTCGTGTCACTGTACCTAAAGTTACGTTGAACTTAGGTATAAAGTTTTTGGACTTTGATAGCATTGAACGCTGTT
TTGTCCTTGATTTGGACTCGAGATATGATCTCATCCTAGGTATGGCTTGGCTTGAACGCCATGAGCCATGGATTGATTGGGGGTCGAAGACCTCAGGCGC
TACGCGCAATGTTCATAGCGAAGCTTTGGAGAGCCATGAACCCACGTTTGCTAGGCAACAAAAGCACTATTGGCGCGAGCCTTTGACAGAAGATGTCAAT
GTGCTGGACATTGGAATGTCTGAGTTAACTAACTCCAATGTTGAAAACACGAATTCCGAGCGTAGCTCGTTGAATATTAGTGATACGGCACGTACTCCGT
TGAGTGTTACTCGTCGTGACAATGAGTCACTGCATGCTGAAAACATGGTTGGCCTAGGGCCGAGTTATCAAGGATGTGATTCCTTTGATGTGTGTGGGGT
GACATGTGAAAATGCACCGAGTGCGGTCGGCCATGAAGGCACCACACTTAATGTCGGTAATGACATCAGCTCTCGTATAGAGTATACTACTACTAGTAGT
AACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATCAGCTCTCGTATAGAGTATACTACTACTAGTAGTAACCACGGGGACACAATTGTCCCGACCCC
AGAGGGGTGTAAGGTCTCATCGAAGAGACGACCGGGACGCCAGGTGGCAACTGTTAAGCGCCAGGCGTCCATGCAGTCACAGAGTGATAATAGTGATACA
CTATATACACTTGTCAACGGAGTGAATGTCCAGGTTGAGGGCAATGTTAGCCTGAAAACCCTTCCATCTTTGGGTGCTCTTTGTGAGCTAGACGAAATGT
CTGATGGCGAGTTTAGCCAGGCCTTGAAGGCAGGAGATTTATCCAAATTAGTGGTCATTAGACCCGATATTGAGTTGAACTTGTCCTCATTAATGGATGA
GTCGGTCCTAGGGGATACCAAGGCGGCACTCAGTGCCCGGAGTGGATCTTCGATCCTTAAAGATCCTTTGGATCCCTTCTATCCTTTGGTAAAGGAATTT
CAAGATGTGGTGTGTCACAACCCACCATCTATCTTACCTCCCGATAGAGGTGTACGTCACAAAATTGACCTAGTTCCAGGAACTAAATACTTCGTAACAC
GGCAGTGGCCTTTACCTAAGGAACAGTGTGACGTCATTTACGATTTCTTTCGTGCTAATCACGCGGCGGGAATGGTGCGGGAGAGTAAGTCTCCCCATTC
CACACCTACTTTTTGTGTCAAAAAGCCTAATACTAAGTGGCGTATTGTGCACGCTTTTAATAAGCTTAATGCTGCCACTATCCCGGCTCAGACACCAATC
CCCAGAAACGATGTTCTTCAGAACAATATGGTGGGATGCACATTGTACACTGCGCTCGACTTAGTCGATGGTTGTTACCAGCTGCTCATGCAAGCAAGCG
ATATTCCGCTAACAGCGGTTAGTACCCCGAGCGGTATGCTCTGGGAGTGGCTCGTCATGCCACAAGGGCTGTCAAATGCCACGGCTACTTTTAACCGTCT
GGTGCCGCAACTATTCAGACCTCATCGAGGCTATGCACAAACATACTTTGATGACATCTTTGTACATAGTCGTGCAACGAACGGTCAAAGTGCCGTTGCT
ATTGCTTTCCGAGCGAAAATCGGATACTTTAGTATGAGCTTGTAATGCCGTTCAGATACACTTTGTTAAAGCAATGCGCAAGACTTTGAAAAGTGCGAGT
CATTTGCTATTCGAATTGAAGTATTTGGTAATCACATTGATCATTTACGAGCGGTGATCGAGTGCATGCACATGAATAAATTGTATGCAAATGCATTTAA
GTGCATCTTTGATGCAGACGAGATTCCCTTTTTAGGGTGCTTCATTGGGAAGCGAGGCCTTCGAGCGGACCCCGCTAAGATAAGGGCCATAGTCGATTGG
CCGGTTCCAGAGAACCAAAAAGATCTACGTAAGTGGCTTGGCCTTGCCAATTACCTGCTTAAGTATAGTGAGAATTACGCAGATATGGCTCGGCCATTAT
CCAATCTCCTTAAGAAGGATGTGGATTGGTGTTGGGTAACACCGAACATGAGGCTTTTCAAGCAGTTAGGGAAAGCCTCCTTCATGCGCCAATACTGGCT
TTGCCCGATCCTGATCGGCCTTTTTTCAGCGTCGTCTGTGACGCATCTGACTTTGCCATAGGCAGTGCTCTGTTACAAACAGATGTCGATGGACGCGAAC
GCGTCATTGCATTCGAATCTCGACAGCTCAAAGTTGCTGAAAAGAACAATCCAGTTCATGACAAAGAGCTACTTGCTATGAAGTACGCTCTAGTCAAATT
CAGAGTACGTCTGCTTGGCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTGCGCACTGCGACACAGTCGCCGCATCTCTCTCAGAGAATGGCT
CGTTGGCTTTCATTCTTTGCCGAATATAACTTCGAAGTGAAGTTTAATCTAGGAAAGCAAAATGCTTTGGCTGACGCGCTATCGCGCCGACCTGACTATG
AGCTTGATCAGGTCACCACGCTGTCATCGTCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAGGATGAACAATGTGTAGCTTTGCTACGTGCTCTTGG
GAGCGAGGAGTTTAAAGACTTGGACATAGAATTGTCGGCACGTTTACGTGCGAGGCTACATCGATATTCTATCGATAATGGCCCTGTTGTGCTATTGCAC
AGTTATTGAGGATAACCCTCGTATCGCTGTCCCTCATGATGAGGAGTTGAAGTATCGAATACTCTATGAGGCACATGATACCGCTTTAAGTGGTCATCTC
GGTCGTGAGAAGACCTATAGCTCAGTGATCCAGGCTTATTGGTGGCCCAAACTATACAAGTAGGTGAGCATCTATGTGCGTACGTGTAAAATGTGTCAAC
GGGTGAAACCCTCAGCACATGCGGCAGCGCCTCTGGCTAGTCTGCCTGTACCCACCGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTTGGCCTACC
AAAAGATTCGGAAGGTAACACAGGCATTGTGGTTTTTGTAGACCGATTGAGCAAGATGGCTCATCTAGCGGCAGTGCCGGACTCTATTGATGCCGAAGGT
ACAGCGAAGCTGTTTATCGACCGTGTGTTTCGACAACATGGTTTGCCAGTGGCAATTGTCTCTGATAGAGATCCCCTCTTCTGGCAAGTTTTGGAAATCC
ATATTCAAGGTGATCGGCGCCCGTTTGGACATGTCCACAGCGGATCGTCCGCAGAACGATGGTCAAACTGAGCGTGTTAATCGCGTCATTAATGACATTT
TGCGCAGTGTTTGCGCTGATACGCCTATGCGTTGGAGCTCCATGCTCCCTATTGTTGAATTTGCGTTGAACAACGCTGTTCATGCCTCGACAGGCTATAC
TCCGTTCTACGTAAACGGTCTCAGCCACCCTCGCGTTCTGTTGACGCTACCACTATGTGGTTCAGGGCTTGGTGGGGGAGAGGTTGCCGATCGGCTTGCT
GATATCAGCCCTGCTACTGTTCAAAAACAGGTAGGCGAGTTTCTCGCGACGCGATTGGATGTCTAAAGAAATGTGCGTGACGCAATGGCTGAAAGCCAAG
ACCAACAAAAACAACAAGCAGATGCTAAAAACAGAGGTTGCATTAAATGTTATCAGGTCGGAGACCTAGTATTACTCGATGCCAAAAACCTACCTACAAA
TGTAGTGTCCGCTGTCTTCAAGACAAAGTTGTGTCCGCGCTCCATTGGACCATTAACGGTCGTTGCTAAGGAGGGACTTGCGTATACGCTCAACTTTCCA
CGAAAATTGCGCACACATCCTGTGTTCTACGTTGG