Description :
From Genome Similarity Track
Location :
Scaffold_128:3451- 8675
Transcript NameFunction/comments
Hyaar_Emoy2810486hypothetical protein

Sequence
5224 bases(100 bases per row)
ATTCGAAGACATCACATTCTTCTCCATGTACTTTGTTAAATCTCTCTAGTTCCAAGAGCAATAGGGTTATCGTCACAAGACCGACCGCCAGACCCTAAAT
TAAACCTTAACCCCTCTTTTTTCAATTAGAATTCAGCACAACGTAACGTACGGGGTATGTTGTATGTTCAGATTAAGAGTGAATGTAATCTAATATTGCA
TTTCAGTTCAGGAGCTCAGCACGAGCCCCGAATTTGTCACGCGGTGGTTACGCCTCTGTACAGTCGCGCATTTGAAGTTTTCATACGACCAAAAATTATA
TGCGTCGTAAAGATTGATACCTAAGGTCCAAGCTTGACCACCATTCACATTAGACATACTAAATGTAGCTTTCGTTGAATTGTAGCAATTCTACATTAGC
AATGATTATCATTCGGTTGACCGAACCATAGAGATGACAATCTTATAGCTTTCAGGAAGCTGCACATGTGCCGTCCCGTCAACATCAGTATTCGCTTGTT
GTTGTCTTAACAGTTCGTACGGTTGGGCACTTTGGCTCTCACCGTTCGGACTCCATCGCAATGGCAATCGCGTCATATTGATCGTCTCTATCTAGGGAAA
ACAACATGGCACCAGTGGCCGGACCACTGGCGGTTGCGCTCGTGCGGTTGACCGCACTCCACGCGATATAACTCAAGTGGAAGAAATCATTATGAGTGAC
TCTGGCATCGAACTCAATTACGTATTCAACTATAATTATTTTCGTGATCATTTGACGGACCACAAAATGCTACCAGGTCTGACAGCGCACGATGATTATA
CACACACAATTTAGGTTTACCTACACTAAACACAGTGTAGGCAGGTGTCTTTGGAACTCACGTACACGGATGTACTGAACGAGCGTCAATAAACAAATGA
AAATGCTTGTCAAATGAGAAAAAATAACTTCATTTACTATTAGAAATTAACCATGTTTTAAACTCCTCGTGACAATGCCCTAGTATCTGTCAATTTACCC
TGTTCAAATCTTCTTTTTACTGTCTAAATACAAATATATAATGTAATAAACTGCTCACTACTCATTGCATGCGTCTTCTGTCTCGGCTCGATCATGTTAG
CTAGATATCATTGCTTATACCGACTATAGAGTAGAGTGTGGCCAGCTGCAGCGAATTATTCTCCTATCAAAAATTATTCCATAATATCCAAATAGATCCT
TAATTGATGTAATGATCGTGTAACGGGCTCACCCAGTTAAAGGGAGTATACATAAAGCATTTTTGCATAAAAGATTCGAAGTAGACGATTCCTGAGGAAA
AAAACAATTTGAAATGCATCGCGATGACGGACTATCGTACTAAGAACAATAAAATCGACGGTGTGCTTAAAAATTTTAATTGCCAGATTCTTCAGCTATG
CTCAAATCATGGATAAACGTAACTATACTGTGAACGGGTGCGTAGTCAACACATGCCATATCAGCAAAGACTCTTGTCGTGCAAAGTTTTGATAGACGAT
AAGGACTGTTCATACTGCAAGACTTAGGCGCTCTCATTTATAAGTTCCAATGCATCGCTAACAGTTACGATTCGCCACATCAATCGCGCTGTGCATCGTG
TTACAAAATGCGTTTTTATGCTCCATTTCTTGCATAAGAAGAAAATAGACGACTGTAATCTCACTTGAAGCAAGTACATTGTGCATTTAGTTGCAATCGC
CTTTTTCGCAATTCATGTGATTCATGCCATGAAGTTTTACACAGAACTGTGTTTACGTATCAGTAGTAATGCGTATTAAAACACCACGGCGTGCGATCGA
ACTAGCAAAGTATACCAGGAAAATGAACAAGTTCACGAGCAAGAAGTACACATATTTTTTTAGAGAAAGGAAGCTAAGTTTAATAATAATTTAATGATCA
CGCGTACGAGTTATCATTTAACGATACTATAGGTCAGTATGTGTTGTCGAAGAAGCGCCCTGGCCAGAAAGTAGCAACCAAAGTGTACGTTTAGGAGATT
AGTAATGCGCGATTTGGCGATTACTAATGTGCGACTATATGATTGGTTTAGTGATATATAGCTATTAGGAATCAGTCGAAGAAACAGTAGTCTTATAGTA
GCAAAACTGGTTGACAACTAAGAACCAAAAATATTCACTTTTCATTTTACCATCCAGTGCTCAACTGCCTTTCTTTCAAATATATAGACAATCTGTAATC
AAGGATATTCTTTTATTTGGAACAGTAAGATCTTAGCAACGAATGGAGAAGCTTGCGGAATAGATGTATCTTAGAGACAATATAGTCAATAATTTTATTC
CCGTCGTCCCTATATCAGGCTTATAGACGGTGTGGGGCGTATCGAAAAGCGACAACCAAGTTAAGAGACATATTATACTACTTACTACCTGAAGTTTGAT
AATAAAATAATATCTAAAAAGCGTTAAACTTCTGACATCAGGAGTGGACAGCATGACGTGAAAGACAAAATATAACCGCCGGATAATTCCGTAAAAAAAC
CCTACTGAATGGCGCACCAAAAGCTTCTTTCTATTGACACTTTTATTTGATAAATCTATATCTAATTTCCAATATTTATGTAAAATCGATTGGCCATATT
TTTATCAACAGTAGAAGATAGTATTTCCGTTACGTGATATTTACATCAGGCAGGCATCAATAGGAATGTTATGCCTACCAATACGTCTTTCTCCTTAATA
TTACCTTTGCAAATAATATTCATTGCGATTAGTAATTATCTGCTCATTGGTTGCTCTAATATTAACCAACAGGGCCGGTCCGCGACAGACGTGCTCAACG
TCAACTGATGACAGTGTAAGTTGGTGCTTCGAGACCTCGCGTAAACGTACATGATGTGGAAAAGTTTGTCCACGAAGTAGAGGTACATTATAAGTGTAAA
AGTATAGATGTATTTAACATAGTTAATCTTCTATCAGTAAATCGATCAAAAAAACTAAATTATGTCTAAAAACAACTATTTATGNNNNNNNNNNCAAGAG
ATAAAAGAAGTAGAGTAAAGGCGAAGTGTCGATAGCATCTGCGCGAGAGCGGGGTATAAAAGTGAAATGTGCGGATCTCTTGAGGAAGAGAAGGAGTACA
GACGAGATGAAGCAAGCAGAAGAGTACTCCTCAGATGGCAGTGATTTTTACACTTCGTAGTTACAAGACAATCAGCCGTGGGAGGAGTGAAGAGATGATA
CGGCCTCGAAGATTGCTAGTGTGAGAGTTGGGTGAGGTGTTGATGCAGTCGTGATCACGTGGTGACGTCACGCGTGGGAGCTCTGGAGCCGTCAGTGTGA
AGGTTCAGTTTCCAAGTCTCACTCTCCAAGGCCCGTGGGTGGGAGTGGAAAACAAGACCACGCTGTTATCAAGCATCGGGAGGTTAAAACTATAGATGTA
TTGAACAGAAGGGATCCTCTATCAGTAAATCGATCAAAAAAACTAAATTATGTCTAAATACAACTATTTATGTAAATATATACTCACCGCTCGTTGAGCA
CGTCTGTCGCGGACCGGCCCTGTTGGTTAATATCAGAGCAACCAATGAGCAGATAATTACTAATCGCAATGAATATTATTTGCAAAGGTAATATTAAGGA
GAAAGAAGTATTGGTAGGCATAACATTCCTATTGATGCCTGCCTGATGTAAATATCACGTAACGGACACACTCCGCTACACCGATTGGAAGAAGTAAGCG
TCATGGGTAAAAAAATGGGCGGCGTGTGATGTATTTGTCTTGGTAACGCTGTCGAATCGGTCGCATAACGGTACTATTTAACTGGATTACGTAAAACTTA
AAGAACTGTCTGCAGATGGTTCAAGTATACAACTATTTTTCAAGGCCTTTTGACATAGAACGTGTTTGTAACCTGATAATACCAGCAGTCAGATTGGCTA
GTGAGGCTATTGTGCTACATTTGCATGTATAAATAGATGAAATGGATCAGATGACTCCAAAAATTAAATCAATTTCTGGATAGCTGACAAAATAGATACC
GAATAGGTCTTCTATGAATACCCGTCGAGGAAAGTTAGCGGGAGGTTTTTAACAGTCAGTCATTTTATAATCAATAGCATTCCATCGAATTTTAAAAGCC
TTAAACATTATTTAAGTGGGGCTGTCGATTCAAATGATCCAGATCAAGTTTTCGGGACCGACTTCTCCAGCAATGAATGATCACGAAAATTTTGCATAGA
AGTCACTAGGATGAGCCCAAATAATTTCGGAGATCTATACTTCAGGAAATAGATTTAATGAATGATCCGAGATAACACTAAGCTATCAAATGTACTATAA
TTCGGTTCGTCTAATACATTTAATTGCGTGTGCCAAACCAAGCAAATAAATCGATAACGTCTCAAAATTGTCGACAAGAGCATGGAACGGTTAGTATGAC
GATTTTTGATTCTATAAACAACACTACAACTTTAACCCTCGCCAAGTCAACATCACATCTCCGAAAACTTTCATCTAGTCTATGCAGTTAGCGTCTAATC
TCAGGACGATCAACAAATAATATTCACGACCTCAATTGTGGCTGACCCGAATCAACGAGCTATCCCAATACATAATCCGAGAAAATCCTACAAGTAACTT
CTACGGTATGCAGATCATCTCATATTACGAGATACGTTCCATAATCTGCAGGCTTACAACTGCCACTAGCTAAGGTGGTGAAATCGGTGCGATTTTCATG
TACATATGCTCACTATGTCAGGATGGGTTGGCCCGTCTAAAAGTGAAGATCTGTCGACGTAGTTATTCTTGTAATCTCGCCAAAAACGTCGTTATTGGTA
AACTGGAGGAGAAGTAAACGACACCCGTTGAGACACGAGGAAATGAAAAGGAAAAATGAAAACCATTATGATCGAGCCACATCGTGTTGAAAAGTGATTG
GCAAATGGAATTGTTAAGAAGTAGAATCTGACCAACAAGATAGTAAACTAATCATATTGAGACACTCACCGGTCTGGTATATATCACAATACGATATTGA
AAAATTAAAACCGATGACTATCAATATCAATATCGAAGCTTTTATGTTAAACTATAAGTCGCGATCTATGATCTGGCGAGGCAAAGCTCATTAAGCCAGT
TGTCGGCGATAACGAATTCTACGGCTAGATATAAATGAGCATCCGGAGGAAGGAGAACCCAAGGTCGGCTAATATTGAGATAACACCGCCTATTGCGTAT
ACAATTACAGACATGTTTTTGCGA