Description :
From Genome Similarity Track
Location :
Scaffold_2028:3450- 5497
Sequence
2047 bases(100 bases per row)
CCTTCCCCGAATTGGTCGCTATTGCTTCCGCGGAAGCGGATTGTGACCTTCGTGGCTGTGGCTAGTGTTGTGCACAGTCTGCCTTTGTCATCTAGAATTA
GCACATGCCCGGAAATTGCGTAGCGTTGCGATTTACGTCCTTGGGCGAGATACTCGGAGCGCCGCAGCAAATAGAAATAACCCAAGACCGCAGCGTCCCA
TAAAACCCGGTCGTGggtgttgctgaagttgagGCTGCGATGGAGAGCTCGTAGGATCTAGATCGTGATGGGGTGCTTCTTCGATGAAGGACGGTCATGT
CGCCGCATGCCGATGACAGCAAGTTTGTGTCCTGGGAGTAGTCCAACGCTAAATCCGAGCTTGAACTGATGATTCCACGATATGTGGCTGATTTTGGAGA
GGATGGTCGACGCTGAGTTGCCTTGTCCTGGTCGTCCAAAACCGTAGCGCCAACAAAATACCGCAAACAGCGCGAGTTGATATGAGTGTTGTGTTCTGTT
GTTGGATAACCACGGGGAGAACTGCATGAGTTGCACCACTCAGTCCATTGTTGCCATGTACCGGCGTATTTGACGGCTGACGACGAGGCCAGAAATTTGG
ACTGCAGTTTGATGAGAACGTCTTGTCTCCATGTTGGTGGAACGTGAACCTGCGACCAATGAACAGAGAAGTTAGACCATGCAAACGGTTCACCCCAGGC
TCTAGAAGCTGCATCGGCCATTCGATTTGTCGCTCCGGGTAAGTGAGCTGCTGACGCCTTAATGTTAAATACTGCCTCTCCAATCCCAATAGCCCGATTG
ATTTCTTGCGCTTCCGAACAGGAACTGGCCAGTCGATTGCTCCACGATACCGCTGACGCGTTGTCGCTCCAACATCGGATATGATGTACTGTCGAGTCGG
TTTGGGAGGTCCAGTGCTTCCCCCAGGTCCAAATAGCAAGTGCAATGCACAGACGCTCTCGAACGTTAATAGAGAAGGAGCCTGAATGGATGGACTgaat
ttcttcttcgtcgaagcGGATTTGAATAAGTTCGTCACGCGTGGGATTTAGCACAGCAAGGCCCAAGTCGGACGCGTCCATGTAGACATGAATGcatggc
gttggtgtcgcGTCGAATATGCATCAGGGTAGCTCCAAAAGGCGGCCGTGGCGCAGAATGTGCTGGAACCAACGGAGGTCCGTGACAACTGCTGGTGGCA
GACGGATACGACCGAAACGGGGCCAACGCACAGCAGCCaaatgaagttgctgcaaaaACGGTTTGGCTGTACGAAGACAAGTCGTAATTTAGCGTAAGCT
GTCGAGTATCTTATGAAGCTCCGTGCGTGTGGCAGCACCTTTGTCTAGGATGTGTTTGATGCGACCAATACCTTTGGAGATTTTCTTTTGAGGAATCGAC
AGTGTGCGCTGTTTCGTGTCCCAAGTTGAACCCCAGAACGGTTAGCCCATGTGGAGAACTTGGCCTCGTTGATGGAGCGTTGACCCAAACTTGCTAGCAT
CGCGTGACGAAGTGTGGCTCTGCTAACTGGAGCCGGTCATCACTGTCGATTTCAATCATGACGTGATCGTCGACCCACTCATAGCCGAAAAATGGCGTCT
GATCGAGAGAATTCGATACTGTTGCCGGAGAATTTCTAGAAACTAGCCACGAGATCGCTCGCCCGAAGGCACCGTAATATTGTGGTGACCCGAACCATCC
AAACGGAGCAGCGAGATCGATGATTAATGCATTCAATTCCCGAAGCATCCCCGCCATCCTGTGTACATGGCAGGCGTGGATCATAAGATGCCGAAATGCA
CCTTTGACGTTGCCTTTTAGGATTCAGATGATTCGGTGTGGGTACGTCACCGCGAGATATTCGATTCGCGCGGCAAGGGTGGTCACGTCAGCATATTCAA
CTTCAGGTAAACAGGTTTTGTCGAGGAGATCGTTAGTAGAAGCCCCCGTCGGAAAGGATAGATCGTGGGTGAGTCTCACTTCGACTTGAGGGTCCACTTC
GCTCTTCTCGCCTGCACCGAAAGGACTGCAGTGCACAGTTGTCCACT