Description :
From Genome Similarity Track
Location :
Scaffold_833:345- 8673
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_833-fgenesh-gene-0.1TATA-box-binding protein
Pytve_DAOMBR484maker-pve_contig_833-fgenesh-gene-0.0Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_833-fgenesh-gene-0.2EF hand family protein
Pytve_DAOMBR484maker-pve_contig_833-snap-gene-0.8DEAD/DEAH box RNA helicase

Sequence
8328 bases(100 bases per row)
CCGGGAACAGCTCCGGCTCGTACTGTCCGCACGAGAGCAACAAGGTGAGCACTGGGTTCTCACTCGCACGATGCGATTCCAACACGCGCCACATACGCTC
GCGAACCGCGCGTGGTCGTTCAGCAGGCCCTCGAGCCGGATCGGGAAGCGGATGTCGCACGTGCCCATGACGTTGCGCACCTTGAACTCGGTGAACTTGG
CGGGAAAGTTGAGTTTCTATCATCGCCACCATCGCACAGCATGAGTCCCCAAACATCGACTCGCAATCAGACCATCAGCGGTGCCAACCTGTATGACGCG
CGTAAACTTGCGCGCTGCTAACCGGCAGCTCTCCTCACTGGTGCCGCCCGTGATGACAATCTGGCCACGCGGCCATCCAGTTGCATTAGTACCACCACAT
CTCATCATGCCATCGCAACATCAGCCAACATCGAAGCGCTACCTTGCCGGATCCGAATATCAGCGCCGTCGTCTTCGGGTCGCGCAGGCGCATGATGACC
GCCGAGAAGCGCTGTTCCAACCACCACCAATCCAATTCAGTACTCGGTCCGTCATTGCGACACATCCATTGCTCCTAATGACAGCTCACCTTCGGGTTGT
ACTCGGCGTTGCGCGCGTGCAGCGCGATGGTCTTGAGCTCCAGCGGCGTCTTGAGGTCGACGGTGCCCACCACGTTCCTGATTCACGGGCAAGGACCGAT
CAGTACGACGCCACACTGCGCGGTCGCGGAGCCAACGCACATGATCTTGACGCTCAGGTTGAGCTTCTCCTCCCAGTCGTCGTCCACCTGGAGCTCGCGG
CCGTCCACCGACTGCAGGTCCCGCGCCGGCTCCTCAATCAGCGCCAGCTGCCNNNNNNNNNNNNNTTGACCGCGCGCGCGCGCGTCGCCGGCGCCTTCCC
GCCCGCCATGTCGCCGCCGCCGTCGGTTGGTTGGGCGGATGCAAGTTCCGCTGCATTGCCCAACGAACATTTAGCGGGCTTTTCAGCCAATCCGAGATAG
TGATTGACAATTTTGTGATTTAGCCAATGGAGTGAAGTTATCCTTAATTTTGAAAGTCGTACGTAATCACGTGTAGTGAAGACAATTCAAGGTGTTGGTG
TCATTTACGACCGGCAGAGTTGCGGTTTCCGGCTCAAGCGATGTGCCACCGCTACGCTGGCGGCCTCAGCAATTGGGTGGGACCACAGCGAGACCAGTTA
GGCTGCAGTACTGTGCTGGACGGTAGCGAGTGTCGTCGACGAACTACGGTGCAGATCCCAACGAGCTGCGGTATCGGCGGCAGCGTTGCGCCAGCTGCAA
AGCTGAATTTCGCCAAAACTGCGAAGGTGGGCGGGCAAAAGCGTACGTCATGGACGGCGTTTTGCAGGGTTGTGGAAAAACCTTGCGCTTGAGGTTTTGA
GCATTTCAGTCGTGTGGAGAAAAAAGCCAGATCGCATGGGCAGCAGCGACCGCGGCCTCCGATTGGCCCGCTCGGCGCCTTGGTCCGGCCGTCGGTCACA
TGTAGAGCGGCCCACACTCCCACAAGGAGGAGGCAGAATAACCTCGTTAGAAAAACCTAAGGTTAATCTTTTCGCGACGACCGCGGGGGAACACTGCGCG
GCCGCCGAGGCGTGGTAGCACAAAAGCGCACGGTGCGCCGAGGTTTTACGTCGGCGGGGTTTTCTTCAAAACCTCAGCGTTTTGCTGGCCCATTTTGAAA
AAAACCGGGCCGCGGCGCGGTGTTTTTGCCTTGTGGGCCAGCCCCCGAAAATTATAAAACCTCCCCGTGGGCCGCGTCGCCCCGCCAGTCTACTCCACTC
GGGCTGCCCGGTGCCGCGCGCGCGAAGCGGGCGAGCGATCGCGAGAGAAGCGCGTCAAGTGCGGGCGGCCGGCGGCCGAGCAGCAGCGAGCAGCCCGCGT
GACTGCCGCGTCTTCCACCCCAGAGCGGTCGTGCACGCCTCCTCCGTCTCCTCCCGGTAAACTACCGCGCTCTTCGCGCTTGTTTTGTGTTGTTTGTTTT
GTATTTTTCCTTTTCTCGCTGGGAATGGTGGTTTTATATTGACGCTAGTGGTGGGTGTTTGGCATTCGCTAGGAGCTCACTACACAAATCCCCAAGCTCC
CAAGCGGTATGAGCATGGACTCGTTCGGATTTGACTTCCCGGGCGGCGACATCCTCGACCTCGGGTCGCTCGGCATGTGGGGCGGCAGCTCCACGCCGAT
GGGCTCGTCGCCCAACTCGGGCGGCGGCGCGCTGCCCTTCAGCGTGGGCACCCCCACGGGCGTCCAGTCGCTCGGCGACGAGCCGTTCGCGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTCGGCGACTCGCCCAAGCCCGCGGGCCACAAGGACGCGGACGGCAGTGGTGCC
GACGACCTCGCGGCCCCATACTTCGGCGGTGACCTCGACGCCGCCACGTCCGCGTCCGTGGCGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGCCGGACGCCAAGAAGGAGCCAACGGCGCCGACGTCGTC
GACTCCCGGGTCGGCCGCGGCCTCGAGCGTGGCCGCGTCCTCGGCGGCTCCGACTTCAGCGGCTGGTCCGTCGGCGTCGACCACGTCGGCGGCTCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGTCCGCACGTTCCGTCCCCGTCTCAGCGTCCCAGCACGTCCGGCCCGCAGCAGC
AAGCACTGCAGCAGCAGCAGCAGCAGCAGCAGCCGCATCAGCAGCAAGAGCGGTATCCTGGCCAGATGATGGTGAACCAGGGGCAAGTCGGCAACTTTCC
TGGCGCTCCGCAGCAGCCTCAGCAGGCGCAGTACCAGATGCACCAAGCGCACCTGGCCGGGCAGAACCCGCAGGCGAACGGCGGGCAGTACATGGCGGCA
CCGCAGCAGGCGTATCGTCCGCCGACGTCCTCGTACGACGAGGAGTTCATGCGCGTCAAGGCCATGATGATGCAGCACCCGGACCTGATCCCGCCTCCCA
TGGAGGTGCTGCGCATCAGCATGAGCCAGAGCAACCCGGCGATGATGAACCCGAACTACATTCAGCAGCAGCAGCAGCGCGGCCAGCAGGTTGCCATGAA
CCGCCCGGGGTACCCGCNNNNNNNNNNNNNNNATGATGGGCGGTCCGCAGGCGGGAATGATGAACCCGAACGGGGTGCGCATGGGAGCTATGGGTCAGCA
GATGGCCGGCGGGCGGCCGCAAGCGCGAACACCGCAGGGCGGCAACCCTGGATCCGGTGGAGCAGGAGACACCCCGACGGCGTGGCAGTCGGAGAACGAC
CTGNNNNNNNNNNGGCGCAAGATGATTGGCAAAATGTACGTGAGCAATCTTGGAGGTGATGGTGGACGAGTGTTGGACTGATGTGGGTATTGTGTAGTGT
GAGTCTGCTGCAACAGAGGAAACCGGACGCGCCGGCCGAGTGGATCCGTCGGCTGCCGGATATGGCGCGCCGCCTTGAGGACTCGCTGTACCGCACGGCC
AAGAACCGTGATGAATATGGGGACTTTTCGTCGCTCAAGACGCGGCTGCAGCACCTGGCGGTGACGATGGGTGCGCGTGCCCAGCACAAGTCGAACGCTC
GGGGCGGAGCTGGCGGTGCTGGTGGAGCCGGCGGTGCTGCCGGAGTGATGCCGAACGCTGCTGCGGGTATGATGGGGCCAGGGATGGCGATGAACGCGAT
GGGCCAAGGCGCAGCCGGCATGGGTCAGCAGCCGCACATGGTCGGCAACATGCAGCAGCAGCAGCAGCAAGCGTACGCAGCGGCTCGGATGACTCCGCAG
CAGCTGATGCAGCAGCAACAGCAGCAGATGCAAATGCAGATGCAGAACCCGCAGATGCGGCAGCAGTTCACGCCGCAGCAGCTGCAGCAGTTCCAGCAAG
CGCAGATGCAGCGACGGCAGTTCCAGATGCAGCAGCAAGCGCAGCTTCAGCGTCAGAACTCCATGCAGCATCAGCAGCAAGCGCAGCAGCAAGCGCAGCA
GCAGCAGCAAGCGCAACAACAACAGCAGCAGCAGTTCCAGCAGAACCAGGCAGCGATGCAGCAGCGACAACAACAAATGCGTCAGCAGCAGATGCAACAG
CAACAACAACAACAGCAGCAGCAACAGCAGCAGCAGCAGCCCAATGCAGCAAACCCTGGAGCGCAACAGCGACCGGCTCCCAACTACCTCCAGGCTCAGC
AGCAGCAACAGCAGCAACAACATCATCAGCAACAGCAGAGAAGGCCTGACGCCACTGCAAACGGCACAGCAAACGGTAAGTGACACTTGGTTGCAGATCG
CTCTGGAGCTTGTACTTACTTGAACTGTGGTGGTGGTGGTAGGACCGGAAGGTCTGCAGGGCGGACCAAACGCGGCTGCAAATGGCGCTCCCGCTGGCAG
CGACGGCATGAAGGCAGAGGGTGTTCATGCGGGGCAGAAGCGCACACTGACGCAGTCTCAGCAGCAGATGGCGGCGGCCGCGAACGCGGAAGCATTCAAG
CGATCCAAGATGGTCAACGCGGCCGGAGGCGTAGCCCCCGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGACTCATTCACCGCAGAC
CTCACAGAATGCGATGCCGAAGCCCGTCCAAGGCGCCGGTGGCGCGTCGAAGACACCCCCCGTGAGCACCGTGAACGCCAAGTAGGCCGCCGTGTCCCCG
CGCTTGTCCCGGTTCACGTAACGTCATCGCAGCTAGTTTCGTCGGCGGCGTCACGTCATTGGAAGGGTGAACTGGACCGTCGACCGGCTCGCCTGGGCTG
ACCCGGTCGAGACGGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGGCAGTTTTGACACGCAACGCTCACGT
TGCGTTCGCGGCGACGATGGCGACGGCGGTGTGGCGACGGCGACGGCGGTGGCGAGCGGAGCCGGCCGATAGAGGATGGGGCGGAGCGGGTGGAGCAGGC
GAGGCAGGCGGCGCCGCGGCGGCCGCGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATAGCGATGATGAAACCCCAATTGAGA
GTTGATTATTTTATGAGCGCTCCACCGCGGGGTTCGAGATGTGATGGATGGCATGCGTCAGTTGGAGCTCAAGGTCGGGAGGCGGAGGCCGGGCGGCGCG
CCTCCGCTCGCGAACATGATGGACTGTCGGCGAGCTCCTGGCGCCTTGGACTCTCGCCGAGTGGCCTCGAGCGCCTGCAGCACGGACGAGCCGAGCGCTC
GAGCCGTGGGGTCCTCGGCCATGTGGGCGTCCAGCAGCATGCGGCGGCGGTAGGCCGTGATGAGCACCGGGAAGGGCACAGCCAAGTCGCCGAGCTTGCC
TGCCTGCAGGTCCTCGAACAGCTTGACGATCGCGTTGCCGTCGCCTTCGTCGCCGTTGGCTGCGGCCTGTGACTGTCGCCGCTTGGGGGACTTGGCGACG
CCTTCAGGCCTGCCGACCGCCGACTTTGGCCGCGCCGGCGACTTGGCGGCTTGCTTGTCGAGGTTCACGCGGGTCTTGGGGCTGTGGAGCTCGGCGCGGA
CGCGCGGCCGGCGCGAGCGCTCCGGGTACATCATGGAGAGGAACTCGAGGAAGGTGATCTCGCCGCTACCGTCGCGGTCGACGCGCTCGATGAGCTCGCG
CACGTCGGCGCGGTTGCGCGCGAGTCCGACGCTCACGAGCGGGTCCTCGAGCTCGTCCAGCCCGACCTCGCCCGAGCCGTCGGCGTCGAGCGACTCGAAC
CAGCGCCGCATGAGCGCGACCTTGTCGCGGTTCTCCTTGAGCTGGCTCGCCTTGCCGTGCTTGCCGAGCCACCGGTGCTGGAACCACTTGAGCTCGTCCG
AGTTGGTCGGCGGCCCTGTCAGACTCGCCGACGGCTCAGTCGGTTGGTGTTGGTGCGTGGGCGGAGGCGCTTGGGTCAAGTGGTCATAGTGGAGCGGCTC
GCGGTGCCGCGCGGGGAGCTGCCGACCCCACTCAAGTCAGTGGCGATGCTGGGATTGCAGCGAGAAGCTGGCTTACCTTGTGCGGAGACTGGCTGCCGCT
GATGTCCTTGGCTCGCGGACTGCGCCACGGCCGGCGGTGCGCCGTCGGGTCCGTCACGCCAGCGAGCGATGTCGACGAGGTTGGCAGCACGGCGAAGAAC
ATCCCACCGAAGTGAGGCGAGGAGAGGACATGTCACGCCGGCCAGGACGCCGAGACGGATCGGCACTCGATGCTGGCTAGCAACCTGGTGATGAGGGACG
ACAGGAACTATAAATACGGCGAATGCGAGGCATGGGGAAAGAGGAAGCAGTAGCATCCTTTGTGTTTATGGTGAGAACCAGTTATGACGGCGAGGTTGCG
AGGCTTCTTCATTCAGCCGCCGACGACTGCTTGCGTCCCTTGGACTTCTTGCGCTTGGGCTTCGCGGACGCTGCGGCCTTGTCTTCGACTGTAGGAGCGT
CAGCCTTGCTGGCCTCGCCATCGGCCTCGACGCTCTGCGGACCCGCCTTCTTCTGCTTGAGCTGCTTCAGGCGATTCGCCTTCTGCAGGTCGTAGCCCGA
CACGGTGCTGATGCGGTGGCGCTGCGGCGGCGCCTTGAGCAGCTGCTTCCGCTTGGACGCGCTGTATACAACAACCACAAGTCAGCCATACCGCCAACAT
GAGCTTGAGGAAGCGACTGAGTGACCCCGTACCTAGCCTTCTTGAGCGACAGCATCCACTCCGGGACGTCGCAGCCCGACAGCTTCATCACGTTAGCGAT
CGCGCGCAGGTACGCCATATCGTCCTCCGTGAAGAACGTGACCGCGTGGCCCGTGCGTCCGCCGCGGCCCGTACGACCGATGCGGTGGATGTAGCTCACA
GCGCTCTGCGGATCACACAGCCAAGTGTTAGCTGCAAGACTCTCCATATACCAGGTAGTCTGCACGTCATACCTGCGGGAAGTCATAGTTGATGACCATG
TTGACAGCCTTGAAGTCCATACCGCGACTCATGAGGTCGGTACAGATCAGCACCCAGACCTCGCCCGTGCGAAACTGCCGGATGACCTCGTCACGCTGCT
CCTTGGTGCGATCCGCGTGCACAGCGCCGATGCTAATGCCGTCGTAGAGCAGCTCGTGGTACAACTCCTGAGCGCGCTCCTTGTTCTGCACGAACAGCAG
CGCCGGCAGACGCAGCCCTTCCTGGATGAGCTGCTTCATGGCCACGAGCTTGCCCTCCTCCTTGCCGACAAACACGAGCTTCTGCTCGATAGTCGTCGCA
CCCGCGTTCTTAACGCCGATCGATACCTTGATCGGATCGCGAAGAACCGACTGCGCCAGCTCCTCGACGCCCTGCAGCATCGTCGCGCTGAACATGGTAC
GCTGCACCTTGGCGTTCGTGCACGCAGCAAGCACCTCGTCGATCTGCTCGACGAAGCCCATGTCGAACAGCCGGTCGGCTTCATCCAGCGTCACCATCTC
GACTGTCGACAAGTCCAGCTTGGTCTCCTGGATCAGGTGCACGAGCCGTAGCGGAGTAGCGATCAGCACATCCTGGTGCACGGTGATGTTGTTCCTGGTA
ATCACAACGATCAAGTTTGTCAGTCTCGATCCAGCGAGTTGTCTGACCATTGTTCGTGCACTTACTTGACTTGGGTGGCGATCGTAGCCGCCGTAGCCTT
CGACAGCAGCTGCAGATGGAGTTTTTTGCCCTTGGACAGCCGCGAGAACTCGGCGTGGATCTGCACGGCCAGCTCGCGCGTTGGCGAGAGCACGATCGAT
CGAACTCCCGTTGCTGCGGCCTCCGAAGCCACGAGGTTGGCCAGCATGGGGATCGCGAATGCCGCCGTCTTACCCGACCCCGTTGGCGCCGTGGCCAGCA
CGTCGCGTCCGAGCAGCATGCTCGGGATGGCCTGCATCTGGATCGGCGTCGGCTCCTTGTACTCGGACGCCTCGATATTCCGGAGCAACACCGCTTTCAT
CTTCTGCTGTCCTTTGGCCATCCGCATGGCCGAGAACTCGGCGATCGGCGCCGGAACCGCCGTGCCTTCCACGCGGATGTTCATTTGTCGGCGGAACAGC
GCAACCTCCTCCCTGGCATCACCATCCAAGTCAGTGCCTTCGCCAGATCGAACTCGAAGTACACTACTCACTTGGCTCTGTCGTTCGTCAATTTTGACGC
AGCAGCTCCTTCAGAACCATTGACACCA