Description :
From Genome Similarity Track
Location :
Scaffold_1315:345- 1684
Sequence
1339 bases(100 bases per row)
ATTCACCGCCGCGAGTTCGGCTGATTAGACGATGGCCCGCCGCCCATGCCGTAATTGCAGATCTGGCATTCCTGAGTTCTCCAGTGATACGCCCCGTTAA
TGACATCAAAACCGACAGCGAACTCGGCGCAGTATCGGTCGTACAGTGCCTCCCACTCGCCGAACGTTACGATTTCGTACTGACGCGCGGGGGTTGAGCC
CAGCCTGCAAATACAAACATCAGTACAACAAGCACGAGTCAGCCCAAACACTCCCAAACAGTCAGTAGTCTCCCAGTCAGCCCTTACGCTTGGGTGGCCT
TGAGGGATTGCTCCAGCGAGAACCCTGACAGGAACAGCGAAATGTATGGCGGCACAATCGTCTTCTGATGCGACAGGCACACCAACTCTGCATTCAGCAC
TGGCCCAGGGGCATCGTCCCCTTGGCTGCGCACGAACTTCCTCCACTTGTTCAGCCACTTCTTGGGCACCAGAAAGTACGTGGCATACTTGCTGCGCCCG
TTCAGCGACAGGTGCGGTGCCAACTGCTGCTGTCTGCTTCCCACTGTGTCCACAGGCGAAAAGAGTCCCTTAGGATATCCGTTCTTCCTCTGCAGCAGCT
CCAGCATCTCTTCGGAGCCTGCAATCTCGCCGTCGAACCTGGCTCTCTTCCTCTCCTCCGCCTCCAGCTCCCTGGCCTCCTGCTCCAGCACGCACGACGT
GCAGTCGCAGCAGGACCGGAGCGTGAATCCTCTCAGCTCTGGCGCGTAGACTGCAATCTCCCTGAACACGTCGCCGCTGACGATAGCGCGACGGCTTCGG
CCTACGCACTGCGCCGCTGGCAGCAGCGCGTCGTGCGCGCACACGATCATGGCTCCCGCTTCCTGAAGCGACGAATTAGCTACAAGCTTGAGCTTCTCTG
CGCCCACGACATCCTTCTTTTTAGCTGCGTTTTGACGCCGCTGTTGCCGCTTGGTCCGGCGGAACTGCAGCAGGAACTGCTCGAAGGCCTGGCAGCGCTT
CTTGTAGGCGCCGAGCCACGCGCGACTGACGACGACGCTGCTGGGCGCGCAGAGCGCGGCGTCCTCGAAGGAGCGAGCGGCTGAACGAGCTAGTAGCTCC
TTGATGCGCAGCATCTCGGCGCCACGTAGCACGGTGAGCGACCGCGGCCAGTGGTCGGATGCGGCTGGCAGGAACGCCGTGACATCGCCGAACTCGCGCG
TAATGACGCGCTCCAGGGCTTGCTGCACGCACACGGAGGAGGCGCTCAGGGCACGACATGTGGAGGTAAGCTGGAGCACGTCCCTGGCCGACAGTAGAGC
GAAGAGGTGCGCCAACAGGCCTTCGGGCAGGTGCTCCAT