Description :
From Genome Similarity Track
Location :
Scaffold_222:34498- 38670
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_222-snap-gene-0.30Transcription factor jumonji (ISS)

Sequence
4172 bases(100 bases per row)
ACCGCACGGTCTAGTGTGCTCTTGAGCTCTTGCAGAATTGAACACGATGGACATGTGTAGTTTTCTACCTTTTCTGCTTTCTCCTTGGACATACCAATAC
AGTTGTCATGAAACCAATCATCACAGTAaTCACATCCGATCATAAagCcATCATACGGTTgACGGCAAACACAATAACGCTCAGTAGCTGACTtgAGCAC
ATCACGATGCATGTCCATGTCGATCACAAGTCGTGCGCGATCATACTCCTCCAGCAGATCTAAGAGATGGGCAATTCTTGCATGTCCCGTATCTAAGCCG
GATGCGAGTACTCTCTTTTCCCAGTCAACTGCGAGATCGACATGCTCTTTCAATGAATCGAACGCTGGCAACTCGATGGCAATCTCATCACCTTCTTCGA
CgAGAGACTTTGCGACGTTCAATGTAAGCCGGTTGGCCTGCTTGGACAtAaGAGTCTTCAGGCGTTTTTtCAGCTTCGCcAGCCATAGCTTTGCTTTCTT
AAGcTCATCCAAGATCATTTTGAATGCCTCAGGTTCAAGCTGGAGAGCGTAAGCTTCTCCAAgAaGGTACTGCAATTCTTCGATCGGTGCGTGCTTGTCT
TCcATCATCTTTGCCACCCGGGTACCCCAAGActGGACAATTCTTTCATGTtCCTTCAAATATGGTAGAGGCCAAAgTAGTGCCTCAAGAAGTGAAACAG
TTCtGTCATCAAACGTTGCGCGATCCTCGCGGATGCGTTTCAACCtaCCCTCCAAATCCTTGCCCTTTTCAACCAAGTCTtGTAGCGGAAGCGACTCGTT
ATAGAAGATAGACCGAGCGCTTTGAAGCCATTCCAGTAGCTCCACTACAACGGCAAGTGCATGTTGCTCAGGTGCAACAGCATTGAACATCGCGCCTTCT
TCCAGAACTTGACTGATTTGTTCTCGCCAAGAATCCAGATGTTTGACCGCTTCATCAGGAGATACTTGACCTGAGGgTTGGTCGGGAGATGTCACGGCAC
TCACTAAGTCATCAAGTCGTCTCGTCTTGTCGTCTTTAGTTTCAACCGCGTTGACTGCTGCTAAACTCTCTTCGACCAAAGCCATCAACGGATCGAGTAC
aGAAATGCCGCGACTGTTTGACTTCTGGGCCTGTTCGTCATTTTGGTCATCATGGgTGCCTTCATCGTtCGTTTTTTtCGCACATCCAGCTTCACGTCTA
ATCTTTTCGATGACTTCGTCCACCTTGAAGCTCTCACTAACAAACGGAATTTGTGGGGAACTTGGCTCTACTCCTGGAGACGTGCTCCGAGCCAGTTCGG
AAGTCGAAGGAGTCGTTCCCTCAATtGAAGATGACGAATCGGGTGCAACTGGCGGTCCTTTTGCCTCCCGTTGTACATCATTCGACAATAGGTTCATAGC
ACCAGCTTTATCTGGTATCATGCTTGCCTCGGTTCCATTCTCTGGGATGTGAACGTTGCTGTTCACACTTCCCAATTCTCCATTGCCGGTCAGTTtCTTT
TTCGCCTTCGTGATTCGATTGAAGACTTCCATGTCGTGATTCTTCAACTGATTGGCTACCGTTCCTACTATTTCCACGGCTCCATTCGCCACAACTTCGA
CTGCCTTTTGTTGCCAGAGCGTGATATCTTCAAGTTCTTTGGAAaGAATTTTGACCTCATCTGGAAACTGGAATCGAAGATTGCGCGATTCATTCATGAG
ACGACGCAAATCATCGAGGGTGGTCGATTGCTTGGACATCCGCTTCTTGCGGGACTGGCGAGGTGGAATCGCATCGCGAACTCGCTGCGTCCAATCTTTT
tCGGCATGAATCACCTCAAACAGCTTAATCCCcTCTTCGAAAaCCAAGGGCAATGCCGCAACcTTGTCTAGCACAGATGTCGCATGCGAGAAATCGCCAG
TTAAGCTCTTCTTTTCCGACTGAGAATCGGTCATCTCGATATCTTCACTTGATGCGGCCCCTGCTTCACTACCAATCTGAGTAATGCCGATTGTCTTGAG
AACGTCCGCTGCTTCTCTCTGCGACTGAAACGTCAAGGTCAAAATATCATTGAGACGACTCGTATACGCCTCAACGTTGACAACAAGTTTGTCTGCCTTC
TCGAGAAGCTTATGGATGACATCAACAGACTTTTTGCCCTTAAGGAACACCGCTGTAGCTTCCGAACGGCTTTCCTTCTTTGAGTTGTCGCccGTTGAAG
AATCCGCCGACGATATTCCACTATGACTTGATCCAGTCGACGCGAAATACTTGTCGAACGAAGCTGAACCAATAGCATCCCGAATCTCATTGATCCACCT
TCGTGCCGTGTCGAGTGCCGACTGGATGTCTCGTTCAATCTGAGGTTTCCATCGAGATTGTTTCTTGGAGTGAAGATGTTTCCGGATAGATTTTGCTTCC
TCGACAATcTCTTCAAGCTCGCTAAAAGGCTTTTtGGCTGCAAGCATGCCcGCTGCTCTTGTGCACCACTCTCTAGCAGCAATTTCGGCCTCGAGATACT
TTTGTTCATCCATGTCCACGGgCATCGCATTACCCTCTTCCAACAATTCCTTCAGTGATTCCAGGGAAACATCAGCGCCGCCTTCGAtaGCTCGCTTTAC
CTTGTCTGCCCATTCATCCGCACACTCAAGTAAGTCTTGCATCTCAAACATCTCCGCACTGTCGTCACAAGGAGCATCGTCTACGAGAGCTCGAATTGCC
TGAAGATCCATTTTCTtAGGCTCAGATGCGCCACgaCGGGAGGTGCGCCGCTTTGGTATGCATTTTCGAACCTTCGCTAACCAGCTTTGAGCATTTAGCA
TTTTCTGCTGGAACAGCTCAACTTCCTTTTCGAAGTTGACCGGTACGAGCTCGATGCGAGCAATCATCTCTCGCATTGCGTTCAGACTAACTTTCTCTTC
CACCAGCATCGTCGTGATGGTTGAGCGTAACTCTCGTGCTTCGGTAaGTACCTTCGAGAATTCGtcGCTTTCGGGAAAaGAAaCGTTTtGTACCGTTACT
aCAGAATACAGTTCTTCAATCTTTCCCAAACGACGGAGTTAGTGGTGCGTTCCGAAAGATAAAGAACTACTCATTCCTTACCTCTTCAAGAAGGCATTTG
GCCTGATTGCGTCGGTTGCTACGCTCAAGAGCGTCTTTCAACCGGCCATACGCCGAATCGAAATCACGCAACCGCTGTTCAATTGATGCCTtCTCGGgCA
CGTCGAATGCAAGATCTTCGGCTTGATGCAAAAGACGCTCGAGCTCAACTCGATCGACCATGGTATCTCTCACACTGTCCTGAGCTGCGAGCCAGTGATT
CAGACGGTTGACAAGTCGTTCGAGCACACCTAACTCGGTCACTGCTATGCCACTAGACGTTGCCTTCATGAGTAATTCGTTCATCTCGTGGTACTTGTCC
ATATCGAGACGAGGTGCACGCATCAACCGATAGAATGCCACAAGCCATCTGCTCTCGAGCTCAGCAGGACTTTGCGACCTAGTACTCGTCGTGGATTCCG
CATATGTCGCTGGCTTGGGGACTTCGATGCTGTGGTGTGCGTACAAGGAGCACGCCGCGTCGGTTGTATTGTAGTCGAAGCGGTGCAGATACTGCAGTGC
CAGGCAcGTGATCTGCTCGTCaGTGTCAAAAGTGGATCCATCGCGAAGCGCTCGTGCCATTTTAAGGTATTTCTCGAGGTCGTTCCCCAACGCTACACAC
ATGCCACCCGTCCCGTCATCATtcGCTTCTTCGTGCTATCTCCATGGCTCCAGACTACGtACCGTTAGCGCGATCGACCGAGTAGCGCGGCTTAGACAAG
TGCATGACCTTGAGCATCTTGGACGCTCGCTCCGAGTCGTCCAAGCGCGGCTTCTCGCCGAGTTCGGGCAGAACCGCCTGGTAGCGCTTGCCCACGCGCG
AGCGAATCGTGATGAAGTGAGTATTCGATGTCGTAGTGCCAGCTGACGAGGCGCCGCTTTCCTTCGAGTTGGTGGAATCGAGCGAGGACGGCGACCCATC
ACGCGTGCGTGTAGCGGCGCCGTTCGGCCTCTCCCGCGAGGCACTGGACGTGGCCACGGCGCCGCCAGGGCCTGTACCCCCTCCCACTTGAGTGTTACCG
CTCGCTCGTCGGCTCATGGCGCACGCGGCGCGTCGCTCGTGCGCAGGGGCGACTCTCGATCTCGGGCCGCCG