Description :
From Genome Similarity Track
Location :
Scaffold_97:344955- 348455
Transcript NameFunction/comments
Phyin_T30-4PITG_19432Amino Acid/Auxin Permease (AAAP) Family

Sequence
3500 bases(100 bases per row)
ACTGGTCAACACGTGATATTTTCACAATATTAGCCTCACCGATTTTGGAGTTATTAGTACTATTAACTCCTCAGGTTCTGTGCAATTCCTCTCGCATTTT
TTGCAGCATGCTTTGCCCTGAACTATAACACTGAGACCCAAGCTCTAACACCGGAGTTGCGCCCTTCGTCATTATCCCATGGCCAGCCGTGGGCATGACT
GGACGTGGGCGTCCAAGCATGTTTTTCATCGTTGGATGGCTACCGTACCGTAGCCGCTACGACACCACTCGACGCACTCCATGGTACACTCACTTCGCGT
TCCACCATCGGATCCACCATGACAAAGGAAACTTTCTTTACGCTTGAGGACATCAAGATTTCCTTTAACCTCTTTTGCTGCGTCTGTGGCATCGGCACGC
TCGGTCTGCCGGGCAACTTTGCTCGTGCAGGCCCCGTGTTCGCAAGTATTGCTATGGCTTTTATGGTGTTCGCTAACGTCTACGCGTCGATTGCAATGTC
CAAGGTGATGCTGCTTGCGCCGTCGACTGTGGTGACGTTCGGTGACCTTGGCGAATGGGCCGTGGGCAAGACTGGTCGCTGGCTATGCACAGGCTCCCAA
ATCATTTCGTGTGTCTTGATTCCGTGCGTCTTCCTGGTACTCGGCGGTGAATTGCTGGACGGGATGTTCCCAGGTGCGTTCAGTCCGACGGTGTGGATTA
TCCTGATGGCTACGATGGTGCTGCCGTTGTGTCTCGTTCCGACGCTGAAAGAAGGTTCCGGTGTTGCGTTTGCCGGCTGCGTGGGAACACTTGTAGCTGA
CGTGATCGGCGTTGCAGTTGTGATGCACGGTATGCGTGGCCATCCTAGTGTCCCGGAGACGAAAGTCAGCTTCTCACAGGTGGCCGGCACGTTCGGCAAC
CTCGCTCTCAGCTACGGCGCCGGTATCATCATCCCCGACTTGCAGCGCGAGCACAGCGAGCCGCAACGCATGCCTCGAGTTATCACCTTCACCATGGTGA
TCATCTCGGTCCTGTTCGTCGTGCTCTCCGTCGTGCCCTTTACGTCCGCTGGCTGCCAGATCTCGGGCAATATCTTGTATACCATTTACCCGGACTCTAG
CACAGGCCTCACGTCGCTGGGCTTTAAACCCCACTGGGGCGCCGTCGTGCTCGCCTACATGGCGATGCAGCTCCATATCACCACAGCCTTCTCTGTCCTC
ATCAACCCGGCGTTTTACATGGCGGAGTTTGTGATTCTTGGCATGCACAGACAGCGCAAGTCGACTGATGTCGAGAACGGACTCGAGTACGCTGAGTCCA
CGACCCCAGCGGATGAGATCATGAAACAGGCGAACGTCGTGGCCGACCACAAGTGTCATTGCACATGTCACGGTGAGACTGACGCCGAGACGACCGAGTA
CCGCGGCGCCAACGCCATCAAGTACATCGTACTGCGCACCTGCATCACCGTGATCCTCGTTGTGTTGTCCATCCTGTTTAAGGACCACTTCTCCGATTTT
GCTGATTTCGTGGGCTCGTCGTCGTTGACCATGAGCTGCATTCTGCTGCCGGTGGCTTTCTACCTGATCAAGGCTTGGAACAACATTCCCAAGGTGGAGA
AGATTGCTGCCATTGTCGTATTTGTGGTTTGCCTCGTTTTCGGATGCTACTCGACGTACACGGCTGGCAGGAACCTGTTCGCTCCATCTGACTCGGAGGC
TTCGTTCCCGTACTGCGAGCTTGAGTACCAGAACACCGTATTTTACAACTCTACGGCTGAGCACGAGACTTGAACACACCGTGTCGAGCTCCAAGCTTCA
AGATATACATATATGTAGCTGTAGCTCATAAATAAGTCCCGTATGCTCCTGGTATATTTTGGTGCCAAGAACTGCGAATCAGTTTGCATACTTGTACAAA
TCATCAGATGTCCATATTTCAACCAATCATATGGATCTTAAAAGCGACATTTAATTACCTTTTAAGATCGTTTAGGTGATAGATAAATTTTATCGATCAC
CACGAGGTTTCTTTCTGAAAAGCCTAACTGGTATTTCTAATCAGGACTACTTCGTACTACCGAATTCCCTTAGTTATCACGTACTACTAGCCGAGTGCCG
CCGCTACGCGGCGGTAGTTTAGGTTTAGTTCTACTTGTTTTGGCCTTCCCGCCTCCGCTACGTTTCGGCGGGATAAATATTAAAGAAAGGCTAAGCCTCG
ATATTTTTAATTCATTAATTTGGGTCAGTATCATGCATACCTGATGAAAAATAATTATTCTAATGATCTTCACTCATGATTCTTACTACATGTACAATTT
CTTTAATATTGTTGGTTATCACTGTAATCTTCATGTTCCACCCAAAACTACCTGCACTTTAAATTACATTTATACAAACGCTACACAATATGTAACGGGG
TACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGTGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAG
GTCGTTCAAAGCCAACCATTGGTCAAACGACATTGCATTTCTATAGGTTACTTATAGTTTGTATTAAACCCAAACTTAACCTACCTATAAATATACTCAG
TTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTCAATAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAAC
TTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTAGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGTTT
GTTGCCATGATAGGAACGACTTCTCCCATATACACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGCCT
GGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCCG
GCGGCGGAAGCAAACCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAAG
TAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTGGGGTGTACA
CTCGGGGAAGGCGACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGGCC
AGCGTTCGCGCTTCCTCGCGTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN