Description :
From Genome Similarity Track
Location :
contig_8:344923- 346417
Transcript NameFunction/comments
g1616.t1hypothetical protein AM588_10006629

Sequence
1494 bases(100 bases per row)
CCCACTCCAACCCAAGCGTCTCAACAACCATGGGCAAGCCCTTCTTCACGATGGAGGATGCCAAGGCGTCTTTCAATCTCTTTGCTGCGTCTACGGCATT
GGTACGCTTGGCATGCCGGGCAACTTCTCGCGTGCTGGTCCAGCTCTCGCGATCGTCGCTATGGCCTTCATGGCCTTCTCCAACATCTACGGTGCAGGTG
GCCATCTGCCGCGTCATGCTGCTCGCGCCAACGTCCGTCAAGACGTACGGCGACCTGGGCGAGTGGGCCATGGGCAAGTGGGGTCGCTACCTCACTGTCA
TTGCCCAGATGGGAAACTGCTTGATCGTGCCCTGCGTGTTCCTGGTGCTTGGAGGCACTCTACTGGACGGACTCTACCCTGGCGCCTTCAGCACGACGAC
GTGGTCTATCCTCATGGCGCTCACGGTATTGCCCGTGTGCCTCGTGCCGACTCTGAAGGAAGGTGCCGGCGCTGCATTCGCGGGCTGCATGGGTACGCTC
GTTGCGGACGTTATCGGCATTGCAGTCGTCATGCACGGCATGCGTGGACACCCGACGGCGCCTTCCCCCGATCTCAACTTTAAGCAAGTCGTTGGTGCCT
TCGGTAACCTGGCTCTCGCGTACGGTGCTGGCATTGTGATTCCGGCCCTCCAACGTCAACACAGTGACCCCACCCGCATGCCCGCGTCGTGTTCGTCACG
ATGGCTTTCACTACGTGCTGCTTCCTGGTGCTTGCTAGCACGGCGTACTCGTCGGTTGGCTGCCAGATTTCCGGCAACCTGCTGTGGTCTATTTACCCAC
AGGAGGACACTGGTTTGACCACTCTGGGCTTCTCCTCGGACTGGGGTGCCATCGTGCTCGCGTACATGTTCATGCAGCTGCACATTACCATCGCATTCTC
CGTTATCCTGAACCCTGCCTTCTACATCACCGAGCGCTTCTTCTTGGGCATGCACCAGCGCACACCCGAGGACATCGAGAACAACCTGCTGAGTTACGCG
GAGGCTGCCACGCCGAACGACGCCGACCACCTGGATAAGTCTCGTGTTTCGAAACGATCCTTCATTTCTGTTGCCGACAACGAAAACGTTCACCTCGGTG
AGCCTGAGGCCGAAGCTGCTGAGTACCGCGGCGCGAACGCCATCAAGTACGTCATGCTGCGTATCGCGATTATCGTGCTACTGGTGATTGCATCAGTGGT
CTTGAAGGACCACTTCGCGGACTTGTCCGACTTCGTTGGCGCGTCGTGCATTACGATGCACTCGATTATCCTGCCGATCGTGTTCCTGATGAAGAAGCAG
TGGACCGTGATGCCGATTTGGGAGAAAGTCACGTCCGTGATTGTCACGGTCGTGTGCTTCTGCCTCGGCTGCTACGTGACGTACACGTCAGGCGAGAATC
TCTTCCCGGACGACGACGGCGTGGAGTTCCCCTTCTGCGAGCCGGAGTTTGAGAACACTGTGTACTACAACTACACGGCGGCGCACGAAAACTA