Description :
From Genome Similarity Track
Location :
Scaffold_184:34492- 35674
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_184-snap-gene-0.24Transmembrane protein

Sequence
1182 bases(100 bases per row)
GCAATTCGCGGCCGTGGGGCTCGTCAGTGGCGTCCTGCCGGGTGTGATCTACCCCGTGCTCCAAGGATACCTGAACGCCGAAGGCACGATCGTCGTCTCG
GCGACGCTGCTCGTGCAATTGCCGTGGTCCTTCAAGGTCTTCTTCGGGATACTCTCCGACTGCTTCCCGGTTTTCGGCTATCGCCGCCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGTCGTGCTGTATCATGCTGTTTTACATGGCGGGACTGTATGTTCCTCCACCTTACTATGGCGAT
CCGTCAATGCACTTTAGCGAGCCTGACGAATGGACCGAAGCGCAGCAAGCTACGATCAACAAGAACGCCCCNNNNNNNNNNCAGTACGTCGTGCCGATGA
TGCTCGCTGCATTTGGGTACCTGATCGCTGAGGTGGCAGCTGATGCCATGGTCGTCGAGCATGCGCAGCGAGAACCGCTGGCTACACGAGGCCAAATCCA
AGCAGCGATCCACTCGGTGCGGATGGGCTTCAATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCAATGGCGTCCAGTAC
GGTGGCCACTTTGACTTTTCGCTCACGTTTCCGCAGATGATGCTCATCCTGGGCATCTTCTGCCTGCCTCTCATTCCGATCACGTGGGTGTTCTTGCACG
AAGACAAAGTGGCTGAGGTGCGATTCAGTGTGTACATCCGCCGGTTCTGGGAGGTCATCCAGCAACGCGCCGTCTACCAGATCGCAGCGTACAAGTTCTT
CTCGGGGGTCTTCAACAACTTCAACATCGTCTCGTCGAGCAACATCAAGTTTCACTGGGTGCATGCGACGCCATTCAACTCGAGTATCATGGTCATTGTT
GGCACGCTCGTGTACGCTGTCACGCTGGGACTCACCGGCAAGTTTGGTCTGCAATGGAACTGGCGTGTCAGCATCGCGATCACCGTCATCCTTGGCGTGA
TCATTGACGGGTTCATGACCATGCTCACGACGTGGGATATCATTCGCAACCAGTGGTTTTGGCTTGGTGTTCCCATCGTCGGATACGTTCCAGATGGCGT
GCGCTTCATTGTCGCCAACTACGTTGTCGTGGAACTCATTGAGACAGGCTACGAGGGTGCGCTGTACGGGCTGCTCACGACG