Description :
From Genome Similarity Track
Location :
Scaffold_9:3449- 4814
Sequence
1365 bases(100 bases per row)
CACAGTTGCTCGGACCGCTTTCGAGTACAGGCCCACTTCGTCTCGGTTCTCGTGCAAGAACTTGATGATGTCGACGTTTCCGTGATCCACTGCTAAAAGT
AGTGCTCGTGAGGTGCAGCCCTCATTGCGATTCTCGTGCAGATACTGGACGATGTCGAGATGGTCTCCCTCGCCGCAGGCGTAGTCCATGGCGTCGGTGG
TACACCCCTCGCTCCGATTCTCATTAAGATACTTGACGACGCCGAGATGTCCACTCCGCGCAGCATTGTCCATTGCCTTGGTAGTGCAGCAACTCGTGAA
GTTCTCGTCGAGGAACTTGATGATTTCAAGGTGGCCTGCTCCTGCAGCATCGTCCATTGCATTGGTGGTGCAGCCTTCAAATCGGTTCTCCTGGAGAAAT
CGCACGACCTCCAAGTGATCGTTCTTCGCCGCTTTGTCCATCGCGTCGGTCGTGCACCCCTCAGTGCGATGCTTGTGGAGGTATTTGACTACCTCGAGGT
GACCTTCGGCAGCAGCGCCGTCCATCGCTGCCGTCGTGCAGCCTTCGTGTCGGTTTTCATGGAGGAACTTGACGACCTCCAGGTGTCCTTCTCGCGCAGC
GTAGTCGATCGCGTCCGTCGTGCACCCTTCGTTTTGGTTCTTGTGCAGGAACTTTACGATTTCAAGGTGCCCTCTCCATGCGGCGTCGTCCATCGCGTCC
GTTGTACAACCCTCTGTACGGTTCTCGTGGAGGAACTTGACGACTTCGAGGTGTCCGATACGTGCAGCTTCGTCCATCGCGTTTGAAGAGCAACCTTCGG
TTCGGTTCTCATGCAGAAATTCGACGACCTCTAGGTGGTCCCTTTGAGCTTTCAGATCTGACGCGTCTGTCTCACCCACTCGGGAGTGGAGCTCAGCGAG
GAAGTCGTCACCATCAGCGCCATCCCAGCTGTAGTACAGCGCTTTTCTGTCTCCTCTCAGCTCCAAATGCGCAGGGTTGTAACTCACCAAGCTGGTGTAT
CTGTCCCGCACCGCACTCTGATCCATCGCCTCGGAAGTACAGCCTTCCGAACGAAACTCGTGCAGGAATTTGACCGTTTGAATATCGCCTGCCACAGCAG
CTTTGTCCATCGCGCGAGTAGTACACCCCTCTGTGCGGTACTTGTGGAGAAACCGAACTACTTCAAGGTGTCCATTCGACGCTGCGCCATCCATCGCAGC
TGTCGTGCAGCCCTCGGAGCGATATTTGTGCAAAAACTTCACCACATCCAGAAACCCGTGCTCTGCTGCGCTGTCCATGGCTTTGGTAGTACACCCTTCC
GATCGGTACTCGTGAAGGAAGCGAACAACGCTGAGGTGGCCATTACTGGCGGCGCCGTCCATAGC