Description :
From Genome Similarity Track
Location :
Scaffold_59:34480- 36685
Sequence
2205 bases(100 bases per row)
CAATCTTGGGAATCAATCAAGGCAAATCTTCTCTACGATGATTGGATAGAACTCAGGGATGTATTCCCAGAAGCAGTACCGTACAAGTTACCTAAGGACA
AAGGTACTTGTCACGAAATAGACCTGAAACCGGTTTCGAAGGACTGTGCCATGGAGCAGTGGCCACTGTCTTGTAAACAAGTACTAGCGATCATATTTTT
TTTGCAGACCACTTAGCTGCCAGGCGTGTATGTGAGTCGATCTCCCCTCATTGATCTCCGAAGTTTTTTGCGCGAATGCCACAAAAGGATAGCGTATTTC
ATATGAATTTAAAAAGTTGAATAATGAAACGGTACCGGCTTATCGCCTATACCGAGGAAAGATGTTACCATAGACATTATGGCAAAGGGTACCATATTTT
TATCAGTGGATCTGATGGATGGATTCTATCAGATACTTATGCGCGAAAGGGGCATCCCGTATACCGCAGTGATTACACCAAGCGGTATATTTTGGAAATG
GCTAGTCATGCCACAAGGACTAAGTAATACCCCTTCTACCAACAGATGTATGGCAAATCTGTTAAGATTTGTACGAAACTTCTTACCCAGTTACGTCGAT
GATATGTTCGTCCATCGCAGAGCTATGGATGGACAGAAGGATGTGGAAATGCATCTAATCCACGTCCGGAAGATTCTTCTACTCATGTGCAAGCACAACT
CGTATGCCAGCATCACAAAGTGAATATCTGCTGCTAGCAAAATACTACTTCCTGGTTGCATCGTGGATAAACATGGCGTACGACCATACCCAAAAAAGAT
TAAGGCAAGCTAGGACTGGCCGGTTCCTACCGATGAAATAGGACTTCGAAAGGTTCCTTGGATTAGCGACTTATTCGCACAATTACGCCTATAAGACTGT
TTAGCTCTCGTTTATTGAAAAGGATGAGAACCGGGTACGAAGTGCCGACCTTCAGCGCTCCTTCAAAGTTATCAAAGAAAACTTGATAAGAACTCCAGTT
TTGGCAATTGCGTACGAAGTCAGGCCATTTATGTGGTCTGTGTGTGATGCGCACAATTTTGGAATCGGCTGTGTATTAATGCAGTACGATGCAGAACGCA
CCATCTTCTATCAGTCGTATCAGCTCCAACTAGATTAACATAACTAGTCCGTCCATGACAAGGAACTTCGTGCCATAACGTACGCGTTGGTGAAGTTTAG
GGTCTACCTACTAGGTGATAGATCCTCTATCGTCTATACGGACCATGCGTATTTACGCGTGGCCGTAAATAGCTCACCTTTCTTGCTGCGAATAGCGAGT
TGGTTGTCATTATTCGCGGAGTATGACGTCTCTGTAGAGTATATGCTAGGACGACTTAATGTCGTCGCTGAAGCTCTCTCGCGCCGGCCCGATTTCGAAC
CGGCTGCGCAACCCGCCACTGGTTCGATCGCTGTTGCGGTATAGACTTCGAGTGTCCAGTCGTCAACTTTACTGGACGACATACGGAACGTGTTTGATCC
GAAGATTGTGTGTATGATGAATCATCTCTCGCAACCTACCCGGAAGAGCCTATACCAGCCGTCGGCAGTCTATCGATCCTCATCACGTAGATATACAACT
TGCGGATTACTGAAATATGTAGCTGTTGTTGGCGACAAGACTCGTGTCGTCGTACTAAATCATGTTGATCTCCAATTGCGTATCATGTATGATTACCACG
ATGCACCTGTTGATGGGCATGGTGGTCGAGAGAAGATATATCTCATGATGAGCCGCGACTTGTACTGGCCCCTCCAGTATTAGTTCGTGCGCAAGTACGT
TCATACATGCAAGGTCTGTCCACGGGTAAAGTCTATTACTTCCTATCGTTTCCCGTTACAGCCTCTGCCTGTCCCGGCTAAGTGCTGGGAATCCGTTTCC
ATGGACCTCTTCTTCGAATTTCCACTGATACGCACAAGAATACTGGTATTCTTGTGTTCGTTGACAGATTCAGCAAGATGGTATACATGTTTCTGTACTC
GAATCAATCAACGCATCGAGTTGTGATTGTGTCTTTATATCGACACGATCTTCCCCCTTCATGGGATGCCTCATGAACTCGTGTCCGAATGGACCCCACG
GTTCACAGCTGAGTTATGGCACTTCATGTTCAAAAGACTCAGAGCGCTCTTGATAGATGTCCACATCTGACCACTCCGAAAAAGATGGTCAGACGCCAAC
CGTGT