Description :
From Genome Similarity Track
Location :
contig_26:34480- 35509
Transcript NameFunction/comments
g5439.t1hypothetical protein

Sequence
1029 bases(100 bases per row)
GGAACAGCGTGAAACCGCTGCTCGAGCTTCGGTGTCACCATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAG
GGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTC
TTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTCAGCACGTATGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTT
TGAGTCCCCACAAAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAATCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTG
GTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAG
AGTATCCAAATACTCTCGAGGCTGCAATTGCGCTCGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCC
ACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGGACCAATGGACCTCTCGAGTGCGACCGCTGCTGGGAACCAGCAGCGTCGTGGATCAACGAATGTGCGT
TGTTTCCGCTGCGGAAACATCGGCCACTATGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCAATACTGGGTATCGTCACGGGC
AATCAAAAAACTAAAGGGACCAGCAGGGCGCCCCGCGCCTGCTGTGATGCAGTCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCA
GTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAGGTCTCTTCGTGCTCTAGTGGA
CTATGGTGCGTCGAACAACTTTGTTCGAC