Description :
From Genome Similarity Track
Location :
Scaffold_50:344754- 349810
Sequence
5056 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCGCTAGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGT
TCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGTTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAG
CCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCGTTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCT
CCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGAAAGGAAGGCGAGAGCCTTCACTTCTGGGTCCGAG
AAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCATCTCCAACCTTAGCGGCCGTGCTAAGAGTTGGGTGTAC
ACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCATC
GTTCGCGCTTCCTCTCGTGTAAACAAGGGAGGCGCGAACTGCACGAGTATGTGCACGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAA
CGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACCCTTGAAGAGGCGATT
CAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGGAGTTCCTTGTCGGCTCCCGGCCGAACAAGCCCCA
ACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCAGCTGCGGGAAGATGGGCCACTTCAAGCGCGACTGTCCATCGGA
AAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTGCTCAGGGTCGCTGGCAGAAGCCAGGATCCCGCGGACAGGGGAACGCCGGGAACCAGTAAGGGCGGG
GCGCCCTACTGGGGAGGAACTAAGCCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGAATTAGCTTCTGAGAGTCTTCGCACTCTCGAATCGGCG
AAGAGCAGCGACGGGTTGCTCGTAGTACACGGATATGTACGAGGATACGATCATCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCAT
GCCACCAGACAGTTGCTCGTAATAGCAACAGGCTGTTCGATGCTTTGAGAGAAAGCAAGGACAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGT
CGTCACTCTTCCCAACGTCCAAGTGGATCTGGCCGCAAGTTTAAAGACTTTGATAGCCTCGAACAGCTCACTGGTCTTGACATGGATCCATACTATATGA
TCCTGGGCATGCCCTGGCTTGCGGAGCACGAGCCCTGTATCAACTGGCGAGGCAAGGCAATCGATGCCAGCCGCCCTGCGAAGTCCGGTAGAGCATTGGT
GAGTCATGTTTACACCTCTGTCAGGACCCAGGGCGCCCGCAAGGGTTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGAC
GACTCCGAGGATGCTTTGATGGTGGCAGCGCCCAGAGGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAAGCGGGTAACTTAGTTCCGCAGACAGCTG
CAGCTGTCACGAATACTGACAATAGTGTGATCAAGGTGGGTAACAGAGCTCCACACACGGTCGCCCAGACCTTAACCGAAGAGGAAGACGTCGGATACGC
TTCCTGTGTGGGTAACATAGTGCCACACGCGGTCGCCTAGACCTTAACCGAAGAGGAAGGCATCGTACACGCTTCCTGTGTGTGTACCACAGTACCACAC
GAGGCCACGAGGGCCTCGGATGTCGGAGCGCCGACATCCCCAGACGTGGATAGCCGAGCTCCACGTCACGGTCGCCGTCAACGACGACACCGCCGCCGCC
ACAAGTCGGATCCGAACTTCGTTCAGATCGACGTCGCTTGAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGAGTTATCA
CATCTTCGATGGCGAGACCGGTTTTTCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGCTGCAGAGATACTGAACCTCGAGGAAATGACG
GCTGAGGCTTTCTTGACCAACCTCAAGGCTGGAGAGATAGCTGAGATGGTACTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACGCCTACTCTGTCT
TGGACGAGAACGTCCTGGAAGACTTGAACAAGCAGCGTCGGACGCGCTTGGGTTCTGCGATTCTTAAGAACCCCAAGGATCCGGTGAATCCTTTGGTGAA
GGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGT
GTCACGAGGCAATGGCCTCTTCCGCGCGAACAGTGTGAGGTCATTGATGCCTTTTTCGCCGGGAAAGCGAAGGCAGCCATGGTGCGGGAGTCGAAATCCC
CGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGCGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAAC
ACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGA
GAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGCCTAACGCCCCGGCGACGTTCA
ATCGCCTGGTGACGCAATTGTCCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGC
CATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTAGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAG
ATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGTGTTCGGGCTGACCCAGACAAGGTCAAGGGTTATAGCAGCATGGCCGACGCCCCGATCCCAGAAG
GATATTCGAAAGTGGTTAAGCTTGGCCAACTACTTTCACAAGTACAGCGCAGGGTACGCGGGCTTCGCTTAGCCCTTGTCGAGCCTCCTTCAGAAGGACG
TCGACTGGCGCTGGGAGCAGGAGTACCAGGATGCTTTTGACAGCATCAAGGCTAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGATCAGACGAAGCC
GTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTACAGGCCGACACGGCTGGACACGAACGAGTCATCTCGTTCCAGTCCAGG
CAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCTA
GGCCCTTTAAGATCTACACATACCACGCATCCTTGAGGACGGCGACTCACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCGTCTTCGCGGA
ATACAACTTTTGCGTCGAAAACAAGCCGGTCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGTCCACATCACGCGGGTG
ACAACGGATCTGTACGATCGGATACGCATGGCGTATCGGGACGATGAGACTGTCGCGCCTATCGTCAAGTTCCTTATGGCAGGAACGAGCGCGAAGTCCG
ACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCCATAACCGGGTGGAGCCCACTGACCCTCCACGGGTGGT
CGTACCCAACGACGAGGATCTGAAGCTCGATATCCTCGCGGAGGCGCATGACGCGCCCTCCAACGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTC
TCTCAGTCCTTCTGGTGGACCCATATGTACAAGTGGGGCGCCCGGTACGTTAAGACATGCGAAACATGTCAGCGGGATAAACCCGCACGGCACTCTTCGG
CTCCACTACAGAACCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGAACACGGTAACACCGGAAT
TTTGGTGTTCGTGTGTCGACTGAGCAAGATGGTACATCTTGCTCCGGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTG
TTCCGCCATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGCTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTC
TGCAGATGTCCACTGCGGACCATCCACAGACAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGACATGTGTGCGCGGCAGAACCATGTACGTGG
TCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGTCACCCCAGAG
TGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAAGTCTCGGATGTGAGACCAGTTTC
GCCGCGGAAACAGGTGGAATCCTTTATGGATACCAAACTGAGCGTTATCAACAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTAC
TCAGAAAAACATGGAAGAGGAAACTTAACTATATTTAAGGTTGGGGACTTAGTGTT