Description :
From Genome Similarity Track
Location :
Scaffold_39:344648- 349045
Transcript NameFunction/comments
Phyca_LT153436424conserved unknown protein
Phyca_LT153437914conserved unknown protein
Phyca_LT1534570871Hypothetical protein

Sequence
4397 bases(100 bases per row)
gactgttccagcgaagcccccggcgcctcatccgttccgactgtcggacttcttttacaaggagattttcggtattcatgatattaaacagggcgacgga
atgcaccaagaacgtgtgcagaacttcttcgtggtcccgttgaatacggagcagttgttcctgttcggagtgctgctcgctctggatagttttctttacg
tgttcacgtacttaccactgcggattctgtttgcctgtggatgcgccgtgacgtcgagtttccacactagagtgttccgaagaacccacttttacgactt
gatggtggctgtgatcgtggcggtagggacgatggtgttgggtcacgtcgatatgtccagagtttaccatgctattcgtggccaggcgatgatcaaactc
tacgtgctgttcactatgatcgagatctttgatcgactcttttcgtcgctcggacaagacgttctagactctttgtactatacagcgaagtatcatccac
gccgcgtaactcggatgttcctggacttcgcagtggcgatcatttacgtggtgctgcactcgcttttgctgtttgcgcaagtggtaactctgaacgtcgc
ggtcaattcaagcaacacgtcgttgcttacgttgctgatttccaacaacttcgcagagctcaaaagctctgttttcaagaaattcgaggagcagaatctc
ttccagatcagctgtagtgacattgtcgaacgcttcaagctgctcacgatcattggactgatcatgctgcaatcctctactggagatgttgcctggggaa
cggtacgttatatattttgcaaaatgttttcgagtgatatcctaactttttcgtgcgaaggctatggtttgggttgctgaaatgctgatcgactggctga
agcacgctttcatcaccaagttcaaccagatcccaccgaccatgtactcgaagttcatcaccatcctttgccgggacctgacggggtggaagagtgaaga
tacgattttggatcacacgcaccacgtgtccaagcgcttagggcttatgtcgttgcctttggcctgtgtggtcgtgcgtatggtgtccaaggcgttgagt
gaagccccaatcgagtttctatcgcctcttggggttcttgtcatcgtgacatttttcctctgtttggcagcttttaaagcgcttttgagcttgggattga
tgatctacgcgtgtaaatctggtcgactggatgacactcgtcctaaaagcccgcgggctgtgagccacctagagtctattcaccgctacaagttctaaat
ggtaaaagttttaagaattgatagacgtttttcttcaaaagcattttgattatcttgttgccaaaagtgtcatgatacagccatactgttgtcacttgct
gttgcgctcgattaccgctcgccgtgggcttttcattgtccttgttctttgctttgatacaagtcctaaacatgcattcctctttttgtatctgtcttat
ctacaaacgcgcaaaacttttggatctttttcctgcttccttgtcactagtttgccttcatcaccttcttcataccccacgcgtcctcttcgctgatggc
cagggtcactcgtcccatgtattcccaccgcacctgcttgttccgcgtctccaacactgtcgggtttcctagctgttcgtcgttcatactccacacgctc
attccctgactgctggttcatagtttttatcccaccacccctttacgcacgactcgtagcgttcatccccattccactcgcgtcattcagcatcatcata
ctgccgtcattgccatgcatctgcggcatgcggttgccacggcttcctccttggaagtggtgggaagcgcccatgccctgcatgccgtacatctggtttg
gctgcaggtgttgctggtgcatgtagcctccgcccattgtagaagccggcaagtgccccatcatcataccattggcgccattatcgaacagattatcgcc
agtgggtgacatgcccatgtccatgcccatatccatgctgatgtccatattcgggaaacgcttaaggatacgagcagtgatgcggcgcccgccagacgtg
ttcttcattgctgcaaggtgcgggcggatggccttgacaagcagcaagcactgctcttcagcgcaaacacacagagcgcgttgcaccacgtagttggcga
actgatcctgcagcatcttgttcatcttgggacagcccgtgatctcagcgatgtacttttggcgcacacgctcgggagccttctcgaggcacttttcgat
cacattcgaactgaatttctgcaccgacagctcgtagatgtggcccagcggcttcataatgacaccgaaggcctcctcagccgtgcaggagtccagtacg
tactgcacaacgtaattaccatacgggtcctgcatcagcttcattgcctggcgctccacttgctcaatcacctctgccttctgcgccttgttagccgcat
ccagacaacgttgcagaacacaacatccgtgacggtgtgttccaacagtcgtacactccttacacaccgcatcaaacacaaactggttgtactcgggttt
cataaactgcagagcacgctggatcacgtggttaccgttcgagtcaatacacagacgcacagcatcatccttaagagcatcaacaataatgtccggcagg
ctcgtcgttctgcgacgttcaccaccttccagacgttcctcacgatcgttcacgtagccgtagtcatccccatcttcctcttcgtagtcctcctcgataa
cgtccggcgaggttgcgcacacttcgaccaccttctgcaccgacctcgtaccgtgcaggttaagagcagcagcaacgaggttggagctcacacggcggat
aattacaagccgctgcttctcattcacacgttcgagcagcttctggaagaggtagtttccaaacggatccaccatcatctcagcaaggtgctccagggat
tcctggtagataacctcgcacaaatcagaacgatcttcgtagtcgagttgctcctgcagaagccggcagccgttctgatccttcgacatagcgaacacac
gattctggatgtcttccacactcaacgcagcactcagacttgacgaatcgtttcctgagttacccatcattggtgcgctcataccaccgccgttcattaa
gcccaagctcatactgccaccagcgttttccgaacgataacccatccgagattgctgacgcccaccaaatcctccgttcatatgatcatctccactcatt
tggtgacgttgctgctgcatcatgtgggacggaggaggcgacatcatcatccgactctgctggtacatcatcgaagcgttctgacggtttgagttgtggc
cacccaagtgctccggagttggagctcctccctgatgcacaaacttacacttgctgcccatacgacaatggccttgcaggaagaacttgcattgcttcat
ccccatctgcatgcctatgcccttacgaggcgagtgtgggggagacgattccggtagcggcggggtcatacgtgagtacatgttacgtccctgggcacgg
ttgttggtgtggcctccgccgcgcatccccatctgctgcgaagcgtatcccatctgcgcgtgcgggtgcctcatcggactcgagcgcgggttcatgtaca
agttgtttccactaacgtcatacattccagtgggcgggtgcggaccaacaaccattgggttccattgacctgcgttcatttgggcccgagacggagcgtt
tccatagccatatgacccgtttgcagtctgcggcgatcggtactgctgttgctgttgacgatactgctgctgttcaacggcatattggttgttgccatag
tactcgtgcatctgctcctggtacatggtgttgttatcaccatcttggctgcccgaccacgagtcttcagacgacatccgcggactcagcgtatatgctc
cactgtaagcagcattgggggcactactggtacctggaaccgtactcgaacgtgaaagcgaaagcgacgtcggcatatgctgctgttgagtgtcacgtcc
accagatcggaaacgctcctgttgcgtggaggacgactgctgttggtgacgatacctgctactcaatccgtactcactcggggactcctgcactggattg
agctggaattggcccgacgcataagcattgacacttcctgccacatttccagctcctggcaacccgttcccgctgtttccagcccgctcgttcgtctgaa
gactcatctgacggtcatccagactcaacttgaggaaatctccccccaaagcctggctgggcgactgcgaaaggaacatctcaatgctgtttttgcg