Description :
From Genome Similarity Track
Location :
Scaffold_1:344634- 356650
Transcript NameFunction/comments
g111.t1XP_008909651.1 hypothetical protein PPTG_14826 [Phytophthora parasitica INRA-310
g112.t1RAW37447.1 hypothetical protein PC110_g6304 [Phytophthora cactorum
g113.t1hypothetical protein
g114.t1hypothetical protein
g115.t1hypothetical protein
g116.t1hypothetical protein

Sequence
12016 bases(100 bases per row)
AAAGTGGCGCGAACCACTCCACGATTCTCATGTTCAGCTCCAATTCGTCGTCCAAGGCCAAGCTCCCAGCGCCCGTGCTGCCCTGGGTGGAGAAGTAGTA
CGTGCACTATCATCGTATGCATTGAATGTGTGCGATTTTTTGACGGGGTTTCCTCCGTTTCTTACTGCACATTAGCCGTCCCAAGAACGTGGACGAGATC
TCGCACCAGGAGCACGTGGTAGCGACCCTCAAGACATCCATCGCCAATGGACAGCTGCCTCATTTGCTGTTCTACGGACCTCCAGGCACGGGCAAGACGT
CTACCATTGTCGCCGTGGGGCGTCAGCTCTTCGGCCCGGATTTCCGCAAGAACGGCCGCTTCCTAGAGCTGAACGCATCCGATGACCGAGGCATTAAGGT
GGTGCGAGAGAAGGTCAAGAGCTTCGCCCAAGGCGCCATCAGCACTGTCAGCGGCCTGCCGCCTTTCAAGATCATCGTGCTGGATGAGGCGGACTCTATG
ACGGGCGACGCGCAATCGGCGCTGCGCCGCATGATGGAGAACTACTCCAAGGTCACGCGCTTCTGCCTCATCTGTAACTACGTGAGCCGCATCATTGAGC
CTGTGGCCTCACGATGCGCCAAATTTCGCTTTGCACCGCTGGAAAAGGTTTCCATGGCGTCTCGCGTCCGGTTTATTGCCTCAGAAGAGCACGTGAACGT
GTCGGAGTCGGTGCTGGATTCGCTGCTGGAGTGTTCGAACGGAGACTTGCGTAAGGCAATCAACTACCTACAGAGCGCCAAACAGCTTTGTGGAGATGAT
GAGCTGTCACAAGATGATGTTATTGCTGTCGCTGGCCTTGCTCCACCGGAGCTGCTGCAGCAGTTCTGGGTCTCTGTAGGCTCCAACAGTTTTGAGAAGA
TGAAGACGGACATTGAGAGTATTCTGCTGGCTGGATACCCGGTGCTGACCATTTTGCGGCAGCTGAATGACGACGTGCTGGCACTGGACAAGCTCAACGA
CGCTCAGAAGGCCAAGATCTGTCTGCGCATTGCTGAGGCTGACAAACGGCTCGTGGATGGTGCCAGCGAGCATTTTCAGCTGCTAGACGTTGCATCCTAC
GCTATGCGCGTCTACCATACCTCGTCGTAACGTAACAGCTTGGCATGGCCGTAAATAAAACAGCAAGGCGGTGATGATAAACACGTGCCCACCAGAGACC
CTAGTATTCGTAAGATAGCAGCGACCAGCAATACAGCTCGGAGGTCAGTGACAAGCTGCTGCTCGCATCTAGTTACTCGAGATTGTTGCTGCTCCCTGAT
CCGTTACAGCAGACATTTGTGTCCACTCGTGGTTGTTACTCTGCTGCTTCCAAAAGGTGACCTCGTCGTCCCCAGCAGCCACACTGAGCACAGAGCCCGT
AAGAGACCAGCTTATCCGATACACCGGCGCGCGGAAGCTGTGGACCACGTGCGACTCCCACTCGCCATCCGCCTCGTCTTGAGTCCAAACGCGCACGGTG
TGGTCGTCCGATCCTGAAGCAATCACGTTCGCCGGGATGCCCACATTCGGTGCCCACGCCACGTCACGAACCCAGTCATTATGTCCGTACAAAGGACTTT
TCACAACTTCCCAGTAGCTACTGCCAGCATTTCCACCTTCCTGAGGCACAGCAACAAGTTGCCAGATAGTCACTGCGTGATTGCACGACCCGGTAACCAC
ACGTTGAACCGGTCCTTGAGCCCCCTGCGACCCCAACGAGTTGTACGGTGCCCAACTCACCGCCGTGCAGCCCATGCCCTCGTCCGAGTTGCGGAAGCTG
GACGAGACCACCCATCCTTCGCGCATGCGAGTAAGGAACGACACCTGCCCGTCCGCCGACGCACAAGCTAGACACAATCCGTACTCGTACGGCGCCCAGG
CCACACTGAGCACAGCGAGCGAGTGGAAGTCATCCACGTGTTTCAGGCGCCATTCCGTCACATTCCCGGCTCCCCCGGTGCCCTGCTGAATCAGCTCCTC
CCGATAGACGTAAACTTTACCGTCTTGGGCAGCCAGCGCCAGCACTGCGCCAAACTTGGGGTGGGCCCACGCCGCGCGATGGATCGGGGCCGACGAGTCG
TCGACCAGAGGCACCACGTGCTGTAGAACGTGCAGCGGCTGCACCTGCTGCGGCTCCTGTCCATCCTTGGGCGCCGAGTGCTCGTCGCTGTCTCCATTCG
CTACTATCGCCTTGGACACGTCGTACACGCGGAAGGTCCTGTCCGACGAGCATGTGACCAGGCGCTTGCCGTAGTAGTCCAGCTGGATGTCATAGATCAT
GTCGTTGTGTTCCGTATCGATGCTGGTCACGGGCGCCTCGCGCTGCTGCTGGACGGGGTGAGGCTGGCCATAAGGCGCCGCAAACTGCCCCGCGAGCTCC
ATCCTTCGTCGACTTTTTAATGATCTAGTCAGTCGGGTACATGCCTCGTAAATTTGGTCCAAGTATTATAATAATACCTGATGGGACTAAATACTATATA
TTTTGTGCATGGACTAAAAACCATAAATTTGGTCCTCCGATCAATTGTAACAGTGATATGTAACAAGTCGGAAGTGAAGTCGTTTTTTGTATTTTGAAAT
TAGAAACCATATTGGTCGGAAACGGCAGCTTTCGACCAATTCTTGTCAGCGATGTTCGCTGTGAATGGGCCGAGCGGCCCAACGTCGCGCAATGAGCGGC
GCGTTAAAAGCGATCGACAACGAGAGGAAGAGAAAGAAGCCAGGAGACGCTGGACCGAAAAAAAGAGGGAGCAGTTCTTCCTGGAGAAGCGATTGCAGCC
TGGCGGCAGCATGAGTGGTAAGTGCTGGAGGTCGTATAGAGAACTGCAACGTGAGCGCCCACAAGGTTTTGCTCTTGGTGTTGCCATGCAATAGTGAAAG
AGAAGGAGCAGACTGTGGAGTCGGACATTTTCAAGGTTGAGGTGGTGCATTTGTTGCGGATGGCGACGCTGTGGTTGACTTTGTCTCGTGTTGGTAGGGA
TGTCGAATTGTGTTCAATGGACGCACAGGCAAAGTGTCGTCGTACGTCTATGCGAGAGCTGGCTGTCAGCGTACCATGTGGGTTGGCTGCTCACGTTGGA
TGCCGCTTTCGTTGTGTGATACAGATACTACCTGGCGAAGTTGGTGCAGGAACATGGAGGAAACGTTGCGTACGTGGGAAGCCCCAACCGTGTCGACGGT
TGCGTCATTTGATGGATACTCGTCGTGTAATATTGGTTATTAGTTCCATGCTCACCGCCACGCGGGTCACGCACATGGTCGGTGTCAACTTGAACGGGTC
CAAAGCGGATAAAGTACTGAAGGTAGGAATCGTTCCTGCATAACCTTGATGTAAGTCTAAGCTAATCTCCAATTCGATAGAGCTCTAAGGTCAAGTTCGT
GAGCCCAGGTAAGTCTTTGCTTTTAGATGCTATAAGCATTGCTGAAACAAACTGCTCGCTTGATTTCACAGAATGGATCTTGCAGTCTGTCAAACGCAAA
AAGCGTGAGCACGAGTTCGAATATCTCGTCTACAAGGATGGCCACGCGGCAAGCTCACTGCGCGCTGCATTCTCACGAGCTGCACCGCAAAAAGAGTAAG
CGCTTCGCACAAAGCTCTACAGATGAATCTCCGCAGCCTATACGCATAAAGCTACAACCGAAGAATGCAACAACAAGTTCAAACGTCCGCTTGTAAAAAG
AGAAAGAATATACCAATGTATAGGGTCACAACTAACCAAGTAGCATTCGTTGTCGTTCCTTTCAGCCAAAACCGAGAAAGCGAAAGCTAGAAGAAGGGTG
AAAAGCTGACCTAAATAAGCGCAGCCTGACGCCCTTTTCCAAACACCACTGAATCCTCGAACAGCCATTCGCCCGCGCCGCACATCAGCCTTGTTGATCT
TTATCCTGTCCTGGACCCCTGAGTGCCACTGGAACAGCTCAGTTCTCATCTCGTGCCTCGGCGCGCAAAATGTCGAACCTACACTGCAGACAAATCAACT
GGCGCGCGACGCGAGCCAAACAGGACTAAACGACACTGCTTAGCAGCATTTTGACCCGCCGTTGGACGGAACTTGCTGGCCGGGCGTCAGCTTGACACCA
GCCTTGGGAGCCACGGGCGCGTTGGCCATGCGCTTCTTGATTTGGGCGGCCATCATCATGAAGGCCTTTTCGACGTTGGCGGCGTTCTTCGCACTGGTCT
CCAGGAATTCAATGCCTAGGCTCTCGGCAAACTCCTTGGCGGCGTCCGTGCTCACCACACGTTTGGCTGTCAGATCGCTCTTGTTACCAACCAGCAGCTT
GTTGACGTTCTCGCAGGCGTATCTAGACATCACAGCGAGCCACAAATCAATATCCTTCCGCGAGGTTTCCAAAGTTAGAGCTGAGACGCACCTATCGATC
TCGTGCAGCCACTGCTTCACATTGTTGAACGACTCCTGATCCGTCACGTCGTACACCACGATGATACCATGGGCGCCGCGGTAATAACTGCTAGTGATCG
TGCGGAAACGCTCCTGGCCGGCCGTGTCCCACTACAAGAGTAAAATATAGATGTTAGCTGCATGTCGTTGCTAAAGGAAACTCACCCACGGAAAGTGGGG
GGGGGGAACGCAGACGTACAATCTGGAGCTTGATGGTCTTGCCGTCCAGCTCGATCGTACGGATTTTCTAAATAAATCAGCATAAGTATAAGTCAGCAAG
CCTGTTAGAACACGATCCCCTCGTCAGCAGTCTGATGGAGGGAGAGAGAGAGAGGTCACTGACAAAGTCCACGCCGATGGTCGAGATGTAGCTCTCCGTG
TACGTGTCGTCGGCGAAACGGAGCAGCAGACACGACTTGCCGACGCCGGAGTCACCGATCAGCAGCAGCTTGAACAGGTAGTCACTGCACGGAACAACCC
CCTCGTTAGTCGGGTCTTGCTTCTCCACTGGCTAAATCTCAGCTCCGCACGTACTATTCGGGGTTCATGTTGGATGATGTCGAGGAGGAAGCGGCGGGTG
AAGGCGCTTAATCTGCAGCACAAAACAGCGACCCAGTAAGTGTGGGTGGTCTTACACTACATGATCTCCCCTGCTGCGCCCCCGTCCGCCGCCCCAAAAT
CCGAAGAAAGATCGAGGATCCACCCTCTTCGGCCAGCCGACGAATCGAGGACTGGACTGGGCGAGCGTCCGGGGGAGGGGAGGGGAGGGGGGAGACGCAA
GGGGGAAGACAACGCAGCTGGCGCCGACACCTACAGAGAGAGAGGAGGCGACTCGCGCGTTCCGGGCGTTCTTGGTCGAGTGCGGGGTCCGCGTCGAGTC
TGCGTTTGGTTTGGGTTCCCAGAGAAGCTTCAGAGAAAGCCCAGGCGTTTCCCCGAGGTTTATTGGGCGAGGTTTTACCCATTTCGACCAATCGCAGCCC
TCAGCGTGGCGAGCTCGTTGTGTGGTGTCTGCCACTTCGTGATGGCACATGGCTACGTTGAAGCGGCAGGATGCAGGCGCTGCAGCACATTGTACTCCTT
GTATCTCGACGTGCGGCGACTCCACTCGTGCAGAAGAGTCGGTGGTGGTGATCCACTGCGCAGGCAGAGCTCCAAGTTGGGCCCCAACGGCAAGGCAAGA
GGCAAATCAGTCCCCGCGCAGAGTCGGGTATGTGCCTGCAGCGTTAACCACATGCGATATGCGCATACCGTCCAGCACAAGATGGCGGCGGCATGTTCTC
GCGCTGTCGGGCTCGTCGCCGCGATGCAAGCTGCAATCTGCCTCCGGAGATTCTTGGCGCGGCGCCATCGCAGGCCGATCCAAACAAATCGGTCTGCTAA
CCCCTTTCCATCTTGTTTTGCAGTGCGCACAACGAGGGAGAACACCCATGCAGGATGCGACCTCATGCGGCGCATCTTGCTGCTTTCGTAGCGACCACGC
GCACAAAGACCCATAAGGCCCTGCGTCGAGCATATCACCTGACGCTGGGAGCTCTGGCATCGCATATTCCGCCGAGATTCATTTGCATGGTTCAACCTGC
AGAGTGATGGTCTCTCGTCCTCCGAGCCAATTTGGTTTCAGCTCGAGAGTGAATTATGTACCCCTTCTCGAAGACCTTATCCTTACAATTCCTAGCATAC
TAGCGTTGCGAAGAGGCGTAGGGGCCCGAATTAGTGGCCCTCGCACTACAAATTATCTGTCCCGGCCTAGGGTTGTAGTAGCTTTTTGTTCCTCCCCCCA
CACAAAGAAAGTGGGAAAGCCGAGAAGAAACGTCGAAGGCAAGTAACCAGATTGAGGCGCAGCGCTCGCCACGCTACGCCTCTTGGGCCCTGCCCTACGT
GTGCATGCGTGCGCGTGTGTGGCGGTGGCGGTGCAGCATCAGCTCGCGTCTCTCGACTCGTTCTGTGGGCTGAGAGAACGCGAGTTACGCCGCAGACCGA
ACCACTGCTGCATTTGGGTTTAGTGTCTATTGGGGGTTGCAGCGTGCGATTTGGGGGGCGCTAATAGTGTGCAGCGACCCTTCGTTCGGAGGGACCGGGA
AAGAGACTGACTGGAGGCGCTGCGTTGTTGTTGGCTTTGCAGACGTAACTATCTCGGAGAAACACTAGCGAGAAGAAGACACAGCCAGCTTTTCTGCTGC
AACGATGAGTTCTTTCAAGAAGGAGCACCCGTTCGGTACGTACCAAGTCTCTGCGGTCCTTGAAGTTACAAACGGGTAGCATGAACGACGTTTAATGGTG
CCGCTTTTTGCAGAGAAGCGCCAAGCCGAAGCGCAGCGCATTCGATCCAAGTACCCGGACCGAATTCCGGTGCGTAACTTACACTAGATGGTTATCGATT
ATGCCAGTAGCTGACAGCAAGACATTTGCAGGTGATTTGTGAGAAGGCGGACCGCAGCGACATTCCGGACATCGACAAGAAGAAGTACTTGGTGCCGGCC
GATCTGACAGTCGGCCAGTTTGTGTACGTGATCCGAAAGCGCATCAAACTGAGTCCCGAGAAGGCAATCTTCATCTTCATCAACAACGTCCTCCCACCCA
CCGGTACAGCTCTCGACGCAACAACTTAGTAAAAACTATGTTTTGTTTCTGTTTCACTAACCTTTTCGATGTTTTGTACAGCCGCGTTGATGTCGAACAT
TTACGAAGAACAGAAGGACGTGGATGGATTCCTCTACATCACCTACAGCGGCGAGAACACCTTCGGTCAGTAGGCCGCGCGTGTTGTCGGCGTGCGGGGA
CTGGATTTTGGTTGAAGATTTTTTCTCGTCGTTCCGGTGGTGGGCTGCAGGCGCAGTGTTCATTACGCTGAGAGCTGCGGTGTTGCCGGTCATTCAGGAG
TCGTTTCTTCGCGGAATTGAGTGCTAGGTGAAGTCTGTGAAAGGAAGCTGAACAACCACAAACGACGAGAATTTGCTGCTACGTGTTGGTCCATTCTTCT
AAAGCTGGCGATGTGGATATTATCCTAGGAACAAACCCCCAGAAAAATGCATGCGATTCTATTCACTCGCTCGATGCCCCACGTGTGATTCATTGCTGAA
CTAACGCTATCGCATCCCTAGTCACATGTAGTTGCGTTGGAACTGCATCATTTGCAGACCTTGGCCAACGACAACAACTTCGTCTGAAGCTGAGGTTTGC
CAGATTGCAAGGTCAGCAATGTCGGCACACTCTGAGAAAGCAGCCCCTCGCCACTCCACGCTACTGCCATTCTCATCACGGTGAATGCTCCACTTGCTTA
CCCGCTGGTCGTACCCGGCGGCAAACACGTCCTGACCGCCAATGCATGCAACAGTTTTGATAGCTGAGCCGCTAGCATTGACCACCTGAGTCTCTGACAG
CATTTGACACGCCGGGAAGCGAAGTTCATGCAGGGACAAGTTCTGGTCATCACCACCGCTGATAAGAGTGACGTGAAGGCCTCCTTCACTTTCGTTTTTC
ACGCATGATACGAGAGTGATGCAGTTCGTGCCCATGTCGTGCGCCATGTAGCTGCCCTTTGGTTGCATGCCTCTAACCAACTCCTGGAGTTTTTCACGGA
ACAGCTCCACACCTCCATCTGATCGTAGAAGCGTAGTGATCTCCTCAAGGAGAGAACTTAAATCCCAGAGCGTCACTAAGCCGTCAGTGGAGCCAACTGC
TATTCCGGCAACCATTACATCACCAACGCCTTCCTGAAAGCCAACGCAGGACAAAATGGGCTTTCTTGACGCTGATCGGCAGTCCCCCAGCTCGAAAACC
TTGCCATGATTTACGTCCAACAGTAAAAGTTGGATAGACCCCTCGGAGTTGCAAGCCGTCACAAGTCGATAAGCACCCGATGCAGAAGGGATAGCAAAAG
TTGCGAGCCCAAGAATGCGATGATCCTGTTCTACGCCAGCTGGCTCGTGGCCGCAGATATGCCGAAGAAAGTCGTTCCCTCCTCGAACCAGCCAAACATT
CAGGCGTTGCTTTCCACCACCCGAGATAATGAAGTGCTCTTCGACGCCATTCTCATTTGTGCGTTGAAACGTTGTAAGCGCTCGCACAGTGGTGGTGTGT
GCGATTCCAGTGGCCACACTAGTCCAGCGCAAGTTTTTGCTTTTGTTTTGGCTGTTACGAGTGCGGCGGCGGTGCAGCATGAGACTATTGTCCTCTGCTG
CGGTAACCAGGCGGCCATCTCCAAGGAAGGCTACGCACGTCGTCATTCGGCCGTGATGATGATCGTGCAGAGAACACTTCGAGAAAATTGGAGAAGGCTT
CGAGACTGTAGCTGCATCGACCCCACTCAACAGAGTCGAATGCACCTTGATGTCCACCTGCTGCTTCTGTGTTGCTGGGGGCGTGAACACAAATGTGTGA
TCAGGTAATGCCGAGTCCTGATCCTCACCTCCGGTGAAAAGCGCGTGCGGACGTCGCCAGCCACCGCATTCAACGTTGAACACTCGATATTGCGCAGAAA
AGTTGTGCAGAACAGCTTGCGCTGCATGGAAACCAAACACCATGAGATCACGCGTTGTCTCCCCGCCAAGAGATGGGCTCCACCAAAGTTGTTTGACTGT
AGAGATCCCCCGGATAGATTCACGCCCCACCTGTACAGCTGACAGCGCTCCATATGCGTCTTCTTCTAGAGCAAATGAGCAAATGTAGCCATCATGGCCG
CCAGATAGCATGACACCATTGCCATCATGATTTTCTTGGGACAACAGAAGTGATGCCACCAATTCACGCCCGTGGACACCTTTGAGCACTTGTGCTGGAA
TTTGCACTGCAGTCGATTGATCCGCGCTGTTCGTTGCAAGAAGTGAGCGATGGAACACATACACGTTGCCATGGCCATCACCTCCAATAATGTTCCTCGT
CGTAGCGGACTTGTCAACCACCAAGATTGATGACGGTGAGCTCTTCGCTGGGATTTTGAACGTTGCTACAAGGTCCATCGCCACAGCGAGTGATGCCAAA
TCCTCACGTGCCTCTGTGATGATTGGCTTCCATTCAGAGAGAACTCCACTAGCACTACTAACGAAAAGAGCGTCTTCTTGCTCCCACCAAATCTTCATGA
CCCGAACATTGGTTTGTGTAGTCCACGACGTTATCAGATTACCCGTGGACGCCTCAACGATGCATACACGACCCGTTACGTCACCAAGCAGCAAGTATCG
CCCCGAAAAATCAATTGAGAATGTTGACAAGCCACCAGTCCGTCCATGAACGGGTGCACTGTCGATGGACGGGATCGTAAAGAAGAGTTCCGCTTGGAGT
GAAAGCAGGCCTAGACGAAAAATCTCGCCGTGCTCCGAGGCTACAAATGCCGTATTACCGCTATCGAGAGAACTTAGGACAATGTTGCGCACACTGTGAG
ATGATGACCCACCTTTCTTCTTTTTCGAGGCAGTAGATTGTGCCGTAATAGGGATGCGGATAGTCTTACACAAGTCGCTTGCTCCGGGTACATCGGAAGA
GGACATGAGCTGGCGTGTGATATCCCAGAGTTTTACAGCGCCATCACCACCTCCCGTAGCGATCACCTTTTGCGAAGGGTGGACACCCGCACGCCATACG
TGTCTGCCCATGTGTCCTTGCAAAGTGGCGACGCAGTTGCCGTCGAAATCCCATAGTTTACAGAGACCATCTTCGCTCGCCGTCGCCACGCCGCATTCCC
AAAAAGATACATCCCAAATACGCGCCGTGTGACCCCAGGATCGAAACACCGGAGAGTATTCACCCTCAAGCAGTTCCGCACGGTTCAACGTGCGTGATAA
GTTGAGTTGCTCCGCCGTAGTTTTGCCATTGTTCGACCAAAGCTGTACAGTGCGATCGTCTGAGACAGAAGCCAAAGAGCGCGCATCCGACGACCACGCT
AGCTTGAACAGCACGCCATCGTGAGCATGCAATCGTTGCGCCGGCTCCACGGCTGAGTTCGGCTCTTCACTCCCATTATCCATCGGATTCCACAGCAGAA
TCTGCTGGAAGACCGTTCCTGAAGCGACCACAAGTTCATCGAGCGAGCGTCCGTGAAATGCCAACGCGTACAGAATACAACGCTCAGCGCACTGCACAGT
GCGTAATATATCGTTACGCACGGGATCCCAAATCTGCACCAAGTTGTGTGCGAGCCCCACAGCCACCAAGATCTTCATGCTCTCCTTCCCCGACGCAAAT
TCATCCGCCAGAAGCTGCACATCAAACACCCAGTCGCAAAACACTTTCGGTTTGCCCAGCACCGCGAACTCTTCAATCCCCTGCGCAGCTTCAGGAGTCT
GTGGGAGGTTATGGAAGCATGACACGCGCTTCTGACCAAAGAAAGCGCCTGCAAACTCGACCTTTGCAGTGCTGGAGCCCAGAATTTCAACGACATCGCA
GCCGTGCAGAATGCCTCGTGTCAACACTTCGTGTTCGCCCAGGAGCTCACCGGTGGCGGTGCTATACAGGAAAATCGTGGGCCCGACACCCACGTACAGT
AGAGACCCATTGGACGAGAATGCCACGAGCGTCACCGCGCCGAGGAAATCCTGCTTTTTGATCGTCATGGTCGACGAAGGTGTGCAAGCCAATCAACCAA
ACCTGTGCCGTAATTTACATGGTAATTTATCGCTGGTCATAAACGGATCGGTGCACATGGCTACATGAATGGTGCAAGTTGAAGTGATGTGCTTTGTGAT
TTACAATATATGTTCACTGAATGTAGTCTACGCCTCGCAGCAGACGCTGTCGGAGGCTTCTAGAGCGACTCGCCAACGCTCTTCCAAAGGAACGGGCGGT
CTGGCTGATCGATGTCGTTTCCGGCACTTGGTGCGCTGCTGTTGGTACTCGCTGAGCTTGGAGTACACGGGCTTCTCCATCTGCAGCACCTTCCAAACAG
ACCGCGCTTTACGGAATTCGATCTTGCTCTTGCTCGGGTCGGAGACAGGAGAAAAGTTTTCAGGTCGCAGCGTCCGCTCTAGACTCTTCAAGCCTAGGTT
GTCGGGAAGACTGGCGCCTCGCAAGAAGAAATCGCGGACTTGCGGGAAAATGGCGTCGGCGCAGGACACGCACTTGGGCACCGCTGAAAACGTGTGTGAG
GCCAGAATCAGCACGAACTGGTGGAGTGCGACTTGGCGCTGGCTGATCACGTCGGGCGAGCGTGAACACAGTAGATGCCGTCTTGGGAACCAGTAACCGC
GCAACGACTGAGCGAACCACGCGCAGCCGAAGCACTGGGGTCGAGCGCCTCCGCCGCGCTGCAAGAAGAAGGCTTGCAACACCTTTTGCATATCTCGAAA
TTCGGAGAAGCGACGCTCGACCGACCACTCGATGCCTGTCTCGGCGAGTGAGCACTGCAAGATGTACTTCGTCGGATCACCCATGCGCAGACTGGGCTTT
GCATTGACCAGTTTCACCACGAGTTTTGGCTTGAGACTGTCCGGTCGGCACGTGATGCTCGAGTGGAAGCACTCATCGTCGAGAAGCATGGCCCCCACTG
TCGGATGGAGCTCCCTGTTCCAGACCTTGCAAATTGCACAGTCAACATTGGTACCGCGGCCTCCATTGCGCTAATTGTAGGATCGGCACGGGGCCACCTT
CACTTTCTGATCCGCA