Description :
From Genome Similarity Track
Location :
Scaffold_20:344628- 347757
Sequence
3129 bases(100 bases per row)
TACGAGACCGTCCGCGAATACGCGGACGTCTTCCCCGATAAGATTCCAGCGGAACTGCCTGCCGATCGAGGCGTCCGCCACGAGATCGATCTCGCGCCCG
GTTCGAAGTACTGTGTGACGCGGCAGTGGCCGCTGCCGCGAGACCAAGTCAAGGCCATCGACGACTTCTTCGAGAATCGCCGTAAAGCGGGTCACGTGCG
TGAGAGTGTCTCTCCACATTCGAGCCCAACGTTCTGTGTGAAGAAGGCCACAGGCGGATAGCGCATCGTTCATGCCTTTAACAAGTTGAATGATGCGACC
ATCCCCGCGCAAACCCCAACTCCCGGAAGGACATGGTGCTCGACGCCATGGCGGGCAGTGTCGTCCTCAGCGCCATCGACTTGATCGATGGATTCTATCA
GATCTTGATGAGACCGAGCGACATCCCCCTGACAGCGGTCAGCACCCCCAGCGGTATGCTCTGGGAGTGGCTTGTGATGCCACAAGGCTTGAAGAATGCT
CCCGCCACGTTCAATCGCATTGTCTCCCATGTGCTGCGTCCGCTTCGAGACTTCGCACCGAGCTACTTCAACGACATCTTCGTGGACAGCCGCGCTGAGG
GTGGTCTCAGCGCGATAGAAGTCCACTTGAGGCACTTAAAACAGGTCTTCCAAGTGATGCGCGAGAACAAGTTGTACGCGAACCTGAAGAAGTGTATCTG
CTGCGCGCCGGAGATTCCGGTGCTGGGCTGCTTCGTGGGCAAGGACGGCGTTCGCGCCGACCCGGAGAAGGTGTTCTCTATCTTCGCATGGCCGACACTA
AAGAACCCTACTGAGTTGCGTCAGCGGTTGGGGCTAGCAAATTATCTCCACAAGTACACGAAGAATTACGCCGGATTGATCCAGCCCCTCTCATCACTCC
TGAAGAAAGATGCCACATGGGTCTGGTCACCCGCGCACCAAGCCGCCTTCGACTCAGTGAAGAAGAGCCTTGCTGAGGCGCCGATCCTAGCTCTTCCCGA
CGACTCGAAACCATATCACGTCGTTTGCGACGCGAGCGACTTTGCCATCGGCTGTGCGCTGATGCAGTTTGACGACGAAGGACGTGAACGGGTCGTCAGC
TATCAGTCTCGACAGATGAAGCCAGCAGAGCGCAACTATCCTGTCCACGACAAGGAGCTTCTCGCGATGCGCTACGCTCTGATTAAATTCAGAGTGTACT
TACTCGGCGAGCAAACCTTCGCACTGTATACCGATCACGCATCGCTAAGGACAGCGATGAAGAGCCCTCATCTTTCCCAGCGAATGGCTCGCTGGTTGTC
GTTCTTATCCGAGTATAATTTTGTGGTTCACTACAAACCCGGCAAGAACAACATCCTTGCAGATGCTCTGTCTCGTCGTCCAGATTACGACCCAGGCGAT
TCGCTGGGTCGACAACCGCTGCATGATGAAGACTACGAAGCCAACTGTGCTATGTGCTTGGCGTCGGGATTGAACCTGACGAGCGTGTCTTCAGAAACCC
CACTCCGCGACGAAATCCGGACTGCGTATGAATTCGATCCGGTCTATTCGAGTATTCTAGAACATCTCCGCTCGCCCAGTGAAAACACACTGAGTGCTTT
GTCCCGCTCCACACGCCATCAGATCGATAGGTATCGGATTGAAGACGGGCTGTCAACGTACAGCATCGATCGCTTCGATGCTTCGCGTGTAGTGGTTCCC
AACGATCCTGACTTGCGCTCGCGGATCATCCACGAGTTCCACGATATCCCCCTTGGCGCTCACTTGGGCCGTGAGAAGACATTCGCCGCAGTGTCGCGCG
ACTTTTACTGGCCCCACATGTATAAGTGGGTGCGCAAGTGGGTGAGGACCTGCGAGATCTGCCAACGCGTGAAACCGTCCGCGTCATCGCAGGCTCCCCT
GCGTCTCTTACCAGTGGCCACCGAGGCATGGCGCTCGGTGTCGATGGACTTCGTCTTTGGCCTCCCACCCGACTCCGCCGGGCGCTCCGGTGTCCTGGTA
TTCGTCGACAGGTTCAGCAAGATGGTTCACCTCATCCCGGTCCCGGATACGATCACCGCGGCCGATACCGCGGTGCACTTCGTGGATGCAGTCTTCCGTC
ATCATGGCATGCCCGAGTCCATTGTTTCGGACCGCAATCCGCGGTTCACGTCTGCTTTCTGGGCGAAGCTCTTCGAGCTATCAGGGACAAAGCTGCTGAT
GTCGACGGCCGCTCATCCGGAGACGGATGGCCAAACCGAGCGAGTTAATCGCGTCCTTGAGGACGTACTTCGCAGCTATGCGACGTCGTTTACGAGCTGG
AGCTCGTTCCTTCCGCTTGCTGAGTTCGCGCTGATCAACGCGGTTCACGCGTCGACTGGCTTGACTCCTTTCTTCGTCAACAACGCTCGGCACCCTCGCG
TTCCATCTCTCCTCGCCGTGGGCCGTCCCACGGCGCCGTGTGGCTCCACTCTGGGTGGGGGTGAAAGAGGCGACAACCACTTTGTGACAACTCCGGTTTT
GAACCCTCAACCGGTTACCATACCGGTTGCCGACAAGCCTTCTACGCCAACACCGGTAATGGACCCTCAACCGGTTTCCATACCGGTTGCCGACTCCTCC
TCGGGTGCAGCCTCATCTTCAGCGACTGTTAACGCAGTGACACACGCCCAGGCCAGGAAGGCCCTGACGACTCCCCGCGACGCAGTTTCCCCTCTCGCCT
CGTGGACGAATCGTGCCCTGATCAGTCCTGGCACCGCTAACGCGGTGTCTCCATCAGCGAACTACGCGCCAAAGCAACCGGCACATCCGGCTGATAACAC
CGCTGTCTCAGACTTCATCCTCCAGATCCAAGCAGTCACCCGATACGTCCGCGACGCGCTGCAGACGGCGGTCGACAAGCAGAAGGAAAACGCGGACAAG
CGCGGCCGCAAACACACAGTAAAGTTTGCGACAGGAGATCGAGTGCTCCTGTCGACTTCAGGAATCAGAGACTCTGCCGTCACCAACCTCGGCGCGAGTA
AACTCGCACCGCGCTTTATTGGGCCATTTACGGTGACTAAGGTTATTGGCGAGGCTTACACACTGGATATTCCCACGTCGCTGCGGCTACATCCGACGTT
CTACGTCGGACGACTCAAGCAATACCTGC