Description :
From Genome Similarity Track
Location :
Scaffold_260:3446- 28672
Transcript NameFunction/comments
Phyag_g4045hypothetical protein PHYSODRAFT_309454
Phyag_g4046hypothetical protein
Phyag_g4047hypothetical protein PHYSODRAFT_474162
Phyag_g4048conserved hypothetical protein
Phyag_g4049conserved hypothetical protein
Phyag_g4050protein kinase, putative
Phyag_g4051hypothetical protein

Sequence
25226 bases(100 bases per row)
AAGTGGGCACGCAGCGGATGTCGGCTACCAGGTGATGCACTTTGGGGGCGTACGACTTGACCTTCTCTACGTGCTCGCACGTGATGGTCCAGTGCTTGCC
ATATTGCTGAGCCAGCTCCCGCATCGAgtccaccacgcgctgctcCCAAGCCTCACGGTCCTCCACTGCCACATTGTCGTGCACGTGGAACCAGCCGCCG
CTGGgcttcagcacctgcacaGCCAACGGCCAAGCCTTCTCACTTGTGGGCAAAAGGCCAAGGTTCACACGATCAGCCACCGCGCCGATCGTAGGGGCAG
ACTCGCGGTTGTCTCCGAGGTACACCTTGCATCGCTCTGCTACATGGTTGCGCTCCAGGTTGAAGCGCAGTGCTGCCACAGAGTCGGGGTTCCACTCGCA
AGCGTGGACGAATGCAGCGCCACCGTGCACGAGGAAGGGGAGAACATAGTAGCCGATACCACAAAAGAGGTCAACGATGGTCTCACCACGACACCCGATG
TTCGCCATACGGGCCTTCTCCGTGACATTGCCCGACGAGAACATAACCCGAGTGAGGTCCCAGCCGTAGATAATACCGTTCTCACGGATCTCCACCCAAC
CATTTGCCTCCTTACTACGCTGCGAGGTGAGGCCCTTGTTGTTCACGTAAAGTAGCTCCACGTGGCTCTGACGTTTCTCGCTGGTGTCGATGAAGGCTTT
CCGCGCAACACGAGAAAACGCGGGTGTGGTAGACGAACAAACGTTTGCCCACATTTCATCGGCAAACGGTGCCCACTCCGGCTCGAGGAAGGAGTCGCGC
GGGATCAACAGGACATCGCTCACAAACTCATACTTGTCGGGTACAGCTTTCACGATCTCAGGCGAAAGTTGGTACTTGCTCGCAAAAATACCAATGGTAC
TGCGGATCACTTCGTTGCGGTTCAGCCCGCTCGTTTTACCGAATTTGTTCGCGTACGCATCTTCATCAGGTACAATCTCAAGCTGATGTAATTCGCTATC
GTTCGTAGAggcaagcagctcatggaTAGCTGCTGTCACCGGAAGCAAAAACATCGTCGTTGGCTTTCCGTCAGTCGCATTCTCAGCTGGCTGCGAGGTA
TTCGCGACGTGAACACGGCGGGACTTGTCGTACGCATGTGCTTTCTCCAACAATgtcttcactttcttcactTGCAACTTTCCAACAAGCACTCCGAGTG
GCTTATCATCTGGAGAGGCCGATACGTTAGTAGTAAGCGAGTTGATTGTCTTCCTCTTGGAAACAGCGGCAGGGGTGTGCTTCGGTGTCGTCGACGACAG
GTGGAACTGATACGTCGACGAATAAAATTGGCCAAACCCGAAGCATTGGAATCCACCGCCCAAAATGTAAAGGGAATTGTTGGCCGGCATCCACGTGCTG
CTATGCCCCACGAATGCTGCATTCTCGTGCTTCAGATCGCCAAGCTCCGTCCATTGTGCAGAGTCAACGTCAAGCATGTACACTTTTTGAGTGGCCTTGT
CACCATTCGCAAGCAATGCAGCCGTCATGCCACCCACCACAATTACCTGGTGATCGCTGATTGAAGCAGTGCTGGCACCAAATAGCGCAGGAGGATGGCT
TTTGTTTCTGGCGTTCTCAAGACTCTGGTTACTCCAGGTCTCCTTGACCGTATCGAAAAGCAAACACGCGGCACTatctgcttcgtcgctgcaATCACCG
CCTTCCAACGTTGACATGCCTCCCCAAAATGCAAGTGTTGTTGCTTTGACTACTGCACCAATGTGATCAAATCGGCGGGGGACGCTATACGAAGTTTCTG
TCAAGCATACAGCATAGCCAACATTTAGCACACATTTAAGGTTTACGATGAATTGGAGATTGGTCTTGCGCACCGATTTGACGCCACTGAAGCGGGCTTT
GACTCATGTCGAGCGCAAACAGGTCACCAAAAACTTGTTTTGCGTCGCGACCACCATACACGTACACAACCGAACCAACTGCATACCAAATCAATCAAAT
AGCAAATTAGTAAGCACCGTCCTTCTGCCACCAGCATTCAAACAAGGAGATACCTGCACAACTGCAGTGCTTCCAACGCGGAGAGGGAGCAATTCCTTGC
GGAGTGATCTTCTCCCACTGCTTTGTTTCAAGGTCCATAGCATAGAGGTCACCCAGAGGTTTGGCTGGGCTAGCACGACCACCAAAAACAATCATACGCG
CCCCCACCACGACAGCTGAATGGTACATCCGAGGCGATGGGCCGTCACCTCCAACTACGGCGTGGTATGTCTTTTGAAGCGAACCATCCTTGGAAGAGGT
AAACACAGTCACGTCGGCAACGCGAGTCGTCGTTCCCGACGCAGTAGGTCCCTGGCCACCGAATACCACAATGTCTTCTTTATACTGCACGCTCGAATGC
CCCACAAGCTTAATGCTGTTCTCGTTGTTCACCTCTGTCCACGAGCTCAGTTCAACAGAAGAGCCGCTACCGTTTTTCACTGCAGGCTGGCAAAACTTCG
TGCGGAAGGCCTCAAAAAGTCGATCCGTCTTTTGTTTGTTGGCCTCAAACTTCTGGTTTGCAATGTCTACAATCCACTTCAGATAGCCCTCATTAACCAG
CAATTGCTCTGCGCTCCGTCCCAGTGGGATCTCCAACCCATTGGCAGTCGTACGGATCGCACACATAATCTTCCTATTGCCGAGCACAACACCCGACTCT
CGGAACCCACTGGCAATAccccactgcagcaactcctttGCCGCGTCCAGATCACGACAAACCACGTGCATGATGAACGGCTCATGTTTGAAAATAATCT
GCAAAAAAATAAACATAATAAACAATCAGCCACGCACCATCACAGCTTTATAAGTATCAAACCAATTACGCACCatgttgctggagctggaatgAGCGTC
AGGTGAGCGCAAAGCCGTCACCAATTGATCAAATGTGATGGTGGCGTGTTCAGCGATCAGCCACTTGCCACCTTTGGTGATCAGATCTGTACCAGTTTCA
GTTCCATTGttcgttgcagcttctccacagAAAACTGCAATGCGACCCGAGCACGAGCTACTCGTCACCTGTCATAAAATGCCAACAACAAACGTGAGCA
AAAATGTTCATTCAAGTACATCCGAACCTTCAATGACTCACGTAGTCCGGATGCGCATTGATAGTTTTGATCATATCGACAATAGGCTCATCAATACAGC
CCTTCGGGCTCTTATCTTCcatcgcctgcagcttcctcaagCTCTCGCGCTTCAGTTGGGCGAACATCGTAAGCCAGCCAGTCGTCGAAAAATGACTGAC
GCACGAGATCACCAACATCTAGTCCGTACCAAATTTATAGTCCTTCTTATTTGGTCCGACAGGCCATTTTAGTCACTTCATCATGGCCGATACGGTGCCG
AGTATCCGCGTGCGCTGCGCCGGCGTACGCGCGAACCAGCGGCGCTCATTACCCACCGACAATGGCCGAGTATTCTTCAGCGAGTCTCAGTACTCCCAGT
CTCCTTTTCTCGTGCGCGTGaccttcgacagcgtcagcttTGTGCACCGCGGGACCCACGTCGTGGAGCGGCGTTTTGTCTTCCCAGGGCGCGTTTTACA
CGCCGTTCTGGCGGATTTCGCCCCAGAAGTTTTAACTAATACAAACCAACCTAAATCTGGGTCACCAAGACCCCGACGAGCAAGAAACTCGTCGCTAAAG
TCCTATTTGCACTCGCATTTGTGCGTTTTGGTGCGTTCCGACTGCTTAAATGTCTACACTGCAGCCGGAGAAGTGTTCGAGGTGGCGCTACCTTTCCAAG
CCAATAGACTTTTCCCTATGGAAGGCCGGGGATTGTTATTACAGCGCAGCCCAGGGGTGCAGATCCAGTCCACTTCGTCTAAAAGACCGAGAGatgcggc
ggcggtggcgctgacgaGGAAGAACCGACGGGCGAGTACCAGTAACagaggagatggagacagATACAAGTTCAGCTCTGGCTCAGGAGACAAAGGGGTG
CATTCCAGACCGAGGTATTTTACGCTCAGACATCCACTGGATGAAGTTAAGCCAGTGGCATTGGATGGAGAGAAGTTTTTGTCGGATGCAGCGTTGGATG
CTGTGGACGTGTTGGAAGAAGGAGGGGCTCCTGTGCTGGTGGCGTTTCATCGCTGGGAGCAGAGATTTCATGTGTTTCGGATGAATGGGGTGGAAACGAA
CGTTAAGAAAGGGGTGGTGCCGGAGGTACGTGTGGTTGATGGACCGACGTGGACAAGATATCGTGCGAGGACCGATTTGGAGGAACTGCGAATGCGTATT
GTACCGGATTGGACGGCAACACTGATGTGGAAATCGCCACGGGTAGGACCGGCGACTGCGAAGCCGATGTTTCTGTCGCCGATTGTCTCGCCATCTTCTT
ACGCGACTGCTTCATCTGTCCCGCCATCGCCGTTAGCGACCAGttcgtcgtcactttcgTCGGGAAATGCTACTAAGGTGGCATTTATCGCGTCTGGCGT
CGATGGTTTTCCGTTGCTTTGCATCATGGATAAGGATTCTGGAACTTTTCTTTTGAAACCCCTAGCACAGCAAGAAAACACTACAGGTGAAGGCGGCAAT
GAAACTGGTGGTGTTCGCATTTTACATTgtcgtgacgctgctccGATCCAGCAGAAAAGTTACGCGAAGTCGTTTAAAGATGGACATTCTCTCAACGGAG
GAGGCTTCGAGGGCTCCGTCGATATTATGATTCTGGAAAAGGATGGCACACTTATGTTGTATAGAGCGCACCATTCAATTTGCCGCCTGATTATTCCTGG
TGTTGATCAGGGTGATCTCGCTGTTAGCAATGGAAATGAGAGTGGTTCAGAGAAAACCCGGTTGCTTGGCAACGTTCAGCTAAACTGTATTGACAGGGGG
CATGCTTACGAAATCGTATTCCCGGATTTGTACGGTAGCTTGGGAGGCAAGATTTGGCGATGCGAGCACCCGTTGAAAATTGTGCGCTCTCCGCTGTTAC
AGCAAGTATTTGATGTGCTGGAGTGCATTATCCCCCCAACAATGCTATGCGCGTTTAAGGTGGAAGTGGTTTGCCGGGTACAGCAGAAAGCTCAAAATAC
TGCAGAACATAATGAACTCGCGGGTGGAGGGCTCGAATGGCAGAGTCTTTGTGAGTGCATTATGGCATTGTTGCCAACGCGAATTGATGGTGCAAATGTA
ACATTATCACCTGAAGCAGTTGGAGCGGCGAGGAACGAtgcttctccttcatgcTCGTCATCACCTTTTGATGCTCTTTGCCAGACTGAGTTTCATGACA
TGTACCAGTATGAGCATGCAATGCTGTTCGCCACGATGGAGTTGCCCGTTGTGGAATCGTTGCCCAGGTGTGAGCGAGCAAATAATTTTGAAGGTTTTCA
AAGTGACAAACGGGGGTGTTTGAGAATGGAAGGTTACGTGGAAAGCATATTTGCTGGATTGCATTTGCTCTGTGAAGAACTGAAGTTGTCAATTGTCCTC
TATCAGCAGCGATTACATCTCGCCAACTTACTCTTGGATATGGCTTTGCAATTGGACTTGGGTCCTTTTGTCTTTTATTATAAAGAGGATAGCTGCATCC
TAAAGCGTCAAATTTCGGCAGTGGGGACAACCAAATCGGAACTCCAACCAAAGAAGCGGAAGGATGGATTGCTTCGTTTTACTACGTATGGATGTGTGCC
TGACTTGATCTTGTGGCTTCAAAATAAGATGACAGCAGACCCCCAGACTTTGATGGAGTTTCCCATAATTGTTGATAAttcagagcagcagctctcttCT
AGCACCTTATTTCGACACCATGAGAATCCGCTTCAGCGAACGGTAGCGATTTGTCGCGTATACGAGCTGATATTCTCAAGTTCAGGGGAGAACGTTCCTC
GTTTACCAACGACACAGGATAATGCATTCAAGCTAATCGTTTATCTCACGCAAGACCCCATCGGCAgcgcgctgtcgctggacgatCTCCCGGTTGGTCT
AAGCTTTCCTATCGTGCAAGCCATCCGCCAAGTGAAGCACCATCCACCTCCTTTCATTACAGAAGATATATGTGCGTTCGTGGGGAGGGAAGACCTCAGT
ATTGCGAACGCTGAGAACCTATCCGACCATTTCGATTTCTTTGGAGCTGGTCagaagcaacaacagcaagatcCTGCCAGTAGTACAACAGATTCAAACA
CTCAAACCGAGGAAGAAAGTGGGGATGACTGTGACGGTCTGGAAGACGTTATAAGTTGGAGTCAACCGCTCTTTCCTGCTGACCAAAGGATGAAAGAAGT
TGCACGATTACTTCGTTCAAGTCGCCCTCTCTGCTTAAAGTTAGAGAAAACACCAGATTTGTCGGACCTCGACtacgcacagcagcagcaagcccGCTTG
TTGCTACTCTGCAAACGATCTATGGCGTTGTCTGTCGCACGTGGCATGGTTACGCTTGGCAGTTTTGATGTTTCTACAGCGCAAACACAGATATGGCGAC
TGCATATACCTGCATTACCTCTTCAAGGCCGTAAGCCACCGACAAATGCGATTGTGGAGCTTGATCTGTCCGGGTACGCAAAAGAATTGACGTATTGGCC
ACAATTTCACAACGGATGCGCCACAGGCCTGCGGCTCCCAGCGCATGATCTCTCGACCGTTATCAATCGCCATTGGATCAAGTACCATCGGCCTCCAGTC
AACGATACTAGTCAACAAAACTCCGGGGGCAGGCAGGCAACAGCGACCCAGCCAACTGATGATGCCGGTCGCACATTGGAAGAGGCGTATGCAGCCCACG
CAGGATTATTGCTGGGGATTGGTCTACGCGGTCATCTCAAGTGTTTATCAATGGCAGATGTGTACAACTATCTTTCGCTGTCGAATGAATTTGTGACTGT
TGCAATCATGCTCGGCATGGCTAGCACCGCTGCGCACTGTCGACGCAAGCGAAAGAAgcaggcagcaacagccaaaCCAgtcaccagcgacgacgagagc
agtTCTCCTGCATCATCAAATCAAGACGCGGAAATGCAACCACTCGAGGAAGATCATTTCTTCTCAGGTTTTCCTGAGCTTACTTCATCAGATAAAACCC
CTCTACTTGGGTCAGGGTTGGAGTTGGCGTTGGAGAGATCGGTTTCCAAGATGTTGTGTCTTCACGTTCCGTCATTGTTGCCGTCACCATTCGGAGGATT
TTCAGTGCCTGCATCTACTCAGACGGCAGCATTGCTGGGACTGGGTATCTTGTACCAAGGCACAGGTTATCGATTGATGACAGAGCTATTGCTCACCGAG
ATAGCCCGATCTCCCTCGAGCGCTCAATTTGTGGGAAGCAACGGCAATACGGGgctgtcgacagcgtcaTTTGATCAGCTGGAGGGCTATGCTTTGGCAG
CAGGAATGGCACTTGGCCTTGTTGTGCTTGGACGTGGACAGACTACAACAGGAGACCCTGGGCTGGCTGACCTAAAGCTAGAGGAGAAGCTTCACAAGTA
CATTGTCGGTGGAGCACAACAATTTCGCGACACAAATGCGGCTGGAAGCTGCCTCTATCGTGGTCGCCGTTGGCAAGCGTTTGGTAGTGGAGGTAATGGT
TTTAACTCCGCTGTGAATGGTAGTACGACAAGTAACGGTACGCCAAACAGCAGTACTGGGGCTTctcctggtgctggacgtgatACAAAGCACTCAAGTG
ACCGCAACGGGGCTCGTGCTGGCAGCGAACACGTAAACATTGGGGTAACTGCCTGCGCAAGTGCTCTGGCGCTAGCGTTCATGTACATGCAGACCAACAA
CAAGGCTGTGGCAGCACAACTGGCGGTACCTGATACACTGATCCTCCTGGATTACGTTCGCCCCGATATCCTGTTGGTCCGCACATTGGCGAAGAACCTA
GTGATGTGGAACGACATTTCACCGACAATGGAATGGATCGACCAGCACGAAGTTCCCGTGCAATTGCTTCAAGCGTACAAAGCTATCCAGTCACACGGCA
ATGATGGAGGGGGAGATACTAACCGAGCGGCGCATCCCAGTGGCTCTCCAGTACATTGTGATCTCCGCTCAATTTGTGAAGCCTATGCGAACATTGTTGC
TGGGGCGTGCATGAGCATTGGGTTGCGGTTCGCTGGAACGGGCAATACGTCAGCCCGTGCTACACTTCGCAAGCATGTTTTACACTTTCGTGAACTAAGA
ACGaagtcttcatcgtcatcatcctcgATGATCTTGCATGGGAGTAGcaacgttgttgctgctgcaacggagCGCGCGACCGTTGAACGGTGCTTGGCCT
TGTGCGCACAGTCACTAGCTTTGATTGATGCTGGAACAGGTCATGTGGAAACGCTGGCGCTTTTACGCTCGATAACACTGCGGCAACGCGTGGACGCGGC
AATGAGCTACGGGAATCACATGACCCTCAGTATGGCAATCGGACTACTTTTCCTGGGTGGAGGGCGTGCCACTGTTTCACGGTCTAAAGAGGCTATTGCG
GCGCTCGTGATCTCACTTTATCCAATGCCTCCAATGAATACGGCTGACAACAAGTATCATCTGCAGGCATTCCGACACCTGTACGTGCTGGCCGTTGATA
CTACGCGATTGTTGGAAACTGTGGATGTGAATACAAAAGCGAGTTGTTCCGTGCAAGTCCGAGTCGATCATCTTCCGGATGAAATCCAAAGCTGCGGCTC
TATTGGCGAAACCCAACCTTCGTATCGAGTGCTGCGAAGTCCATGTCTTCTGCCGGATATCACCACTATCGAACGCCTCGTCATTTCTGATCCTGAATTC
TATCCGATTGAAATTCTCACATCTTCACCTTCCCACGAGCGAACATCTTTGGAAAATGGCAACAGGAAAACAGCGAACGCTCTACGGTTGGAACTTTTAC
GAAACAAGAACGTGGTTTTTCTGAAACGCCGACAACGGAGGATTTATGGCGGCTTTACGGATTTTACGAAggagcttcagcagctgcatgaTGTGGATGT
GGGGGAATCTGGTATCGGCGACTACAACGACAACCGCTTATGGACACTTTTTCGGTCGTATTTATCGACGGGAATCGTccgtgacgatgacgactgTGAA
GACTGTGAGGATGATGGAGATGTGGCAGATTGGGGAAGCAGTTGGTGGGCATCTCAGTTGAATCCGCGAGCGCTGGAACAGGTTAGAGAGGAGACTCAGC
TGCTGATGCCACCTCATCTCAATGCTTTGCACGCGCTGTTTCGGCTACAGCAAGTACCGCATTTGGCTTGTTCCACGGAGGTTGTGGGCTTAAGCTTTTT
CAATGAGTACTGCCGATTGCAAGTGTCATTTACGGATAACGTCTCGGCGGACAATGCTTCTGAAGACCAGGTCGGACCAGGGGTTATGGAGAAGACACCT
GAGTTCGGGGCGTGGCTATCAAACCAAACAGAGGAAGCACTGGGTGCCCTCTGGCATCGAACCTCGTTGGATATTACTTCGTTGGCTTCTGCGCGAGTTC
AGCTACTCGTTGAAACGACAACCCCGACATCGCCCACCAAAAGAGCTCAGTCTGCGCTGGATGCTTTCTTCGTGAGTGTGTTAGTACGGTACTTTGCTGG
CCCGTCAGTATCATCGCTACCGATTGCAAAACAGCCACAACCTGCTGACAAAGATTGGAAGGCTAAATTTCAGCGAGTGCTGGCCGCGTGCTCGCAAGCT
CAACATCCAGGCACGATGTCGCCGGCACGATTCCAGCTATCTGCTTTTCTCGACCAGGACGAACTTACGGAAGCCGAAAAGACTTTCTGGCTGAAGTTGG
TGTCATTCTTCCTCTTTTCAAATTAGCAAGCGGTGCAGGATGTGTGGCTAGCGTCAAGGTAGGAAGGATGCATGAAGGACAATGCGTAGTTATGGTTTTG
CTAGTGTTATTTAGTTTTTATTGTCTTGCAGGCTCTCACGTTGATCGCTTGCAAGTGTGTTTTCCTATCTATTCATCCCAGACCAACAAGAAAGAGAACT
CAATCTTCATCAGGAATGGGGACGGCCATCACCTGCACTGTTTGTCTGGTGGCACCTTCATTTTCGCGCGAGCCTGCATACACACTTGATGTCCGTCCGC
TTGCTGCTCAATCAGAAAGTCTGCTGCTCACCAGATCCGTGTCCCGCAAGATTTGTCCTGGTTGTTGAGATGCACCCGCGAAGACcctcgctgctgttgc
taccTCTACTTCTTTTTTTGTGGGAACTATTTCCTCTTTTTTTTTCTCCATGGCATGCCATGGTGTTCCtcttttcttttttttttgccaTGCTTCACCA
CGCCATCACTGCAACCTCCTCAATTCAGTTTGGCAAAAGTGATTTTCATTTTACGTCTCTTGCGCGGCGACGACACGGCTACGGGAGCCGCTGCCGTCTC
CAGGGgcttcttcaccaccttcacgGGAGGTGAAGTGATCCCAGGAGCTGCCGCACCATTTGTCGACGTATTGGCAGCATCCAACGGTTTCCCATCAGGG
CTGCCTGTTCCACCCACAGTTTTGCCATCACGGTCACGCTTACCTGTCATTTCTGGCGACGATACCTTCgactccaccttcttcggCTTGACCGGGGTGC
TGTTCAGAGATTCAGTACCGTTCGTCATATCGCTACCGTCAGCCGCAGGATCAGGGCTCCCTGGTTGCGAAATGCTGCCCTTGCCGTTAGCCATATCAGT
TGCCAGTGATGCCGCTTTCTGACTGCAGGTCAATTCATCTCCATCCTCTTGCGAATGCGTACCCTCATCACCTGAAGGCGGAGGGCtcggcgctgcagcc
tcctccgccttcttctcctcctctttcttcttcttcatgaactcACGACGCGAGACGCGCGCAATAGCTCGACCACCCATGTCTTCGAATACACTTTCGG
GCAAGGATTTCCAAACAACCGGCGTAACCCTCACGTCCATGGTCGCTGTGCGCTTGTTCCAGCGGTAAAGGTCGTTGTTTTTGAAGTACTCCACTGAACT
GTCGATACTCACTTCACGACTGCGCAATTGGCGGCGGTCAATGTCAAAGCCCACGTAAAAACAAACACCAAACTTGGTGGGGGCTTGACCGTTAGACTGT
TCGCCTGTCGCGGCCTCTCCACCTGTCACGAAGCTCAGTGGGAACTTTTTCGTGAATGCACGCAGACGACAGAGCGCTGGGTTGTACGCCAACGATTCCA
CCAGTTTACGCATACGAGACTCACAAAAACCGCACCACGCCTGCTCCTCATCCTGCTTCTCCGTGTACACCTCAACTGCGAGGTAGTGTTGATGGACGGC
GAAAAAGTCCGAAGGCTCAAAGAGCGGTCCCCACTCCGATCCACCCTTGCTGAGCACATCCTGCACAATGGTCAAGCCCCGCTTGaactcctccttcatc
aCCGTCAGACTGTGCGTCGACACGTTGAACGAAGAGTTCATCGACGGGTACGCCGGCGTCAGGATCGGCATCACTTGGTAACTGTCCAAAATAAAATCAT
CAGCACCATATCAGCACAAATCCAACtaaaacaacaacaataaagCCTCTCACTCACCGGTTATGGCCAGTATTAGCGTTCCAGACCTCCAGTCCGAGGT
TCGCGTCGTGTGTCTTACACAGCTGAATAGCCAGGGGCCACTTCCAATTGTTCAGCACCATAAAGAAcctcaacagcaacgtcgacggcgctgctgttgg
atACAGCTGGTTAATAAAGCACACCAAGATGCACCAGTTGACACCACCTAAGTATCCCATCTTGTTCGAGTACAGTCCGCGTCGTTTCGCCCATCGGCGT
ACAATCCGCAGCACACTGATAAAACTCTCCCTATTCGGCGTGAGTTTAATCATCAGCTCCGTCACTCTCGGTCCATTGAGActcttctccgtcgccggGT
CCACCCCGACCAGCACGTGGTCATCCAGAATATTTAAATTCTCCGGAATCGAATTGCGTGGCAAGATAGCGATCTGCAGATCGATGTTGATCTCCTCGTA
GTCAAAAGTAATCAACGGCACAATCGCGCCCTCAATCGCCACAAGGTTCGAAACTTTGGGATGTTTCAGGAAAATCTCCTTCAACGACGAGAAAAAATCC
TCGCGGGTGACGTGGCGCGGTGCCACGCAGATGGTGTCAATATCCGCGCCCGGTTCATTGACCCCGAGGCGGTACGAGCCGGACACCAGAATCTGTCCGC
CGGCGTCcgccgccatctcctcgGGCACGCCCTTGTCCATGCAAACCTGCTTCACCCATTGGCGGAAAATGGACCGCAGCTCGGCCAGGATCAGCGAGCG
CCGCGTGATGTTGGCGTCCGACTCGGTGGGgaagttgtcgtccatgaacttctgcagcttggtcgACTGCTCCAGGTCTTTGGGCTCGGGCGGCGTCGTG
CGGATGGCCTTGTacgcctgctccagcacgtgcGGCGCCACTGTGAACGTCGCGCTCTGCATGGCTcgagagaagagagagagagagaagaCTAGTGAGG
AAGAGAGGTTTCGTTCGGCCTCTCCGGACGTGCgtgcgacggcgtcgatcCGCTTCTGTCAGCCGAGGTCAGGTTTCGAAGCTCTGGCTTCTAGATTTTA
TTGGCGGAAACAGGATTTTTGGTTTTAGCCAATGAGGGCGGATTATCAAGTTTGAATTTTGAAACTTGGGGAAAAAATCCGCGGTTATAATTGAATTGAC
GAATTATGGACGACATCGAGGCGTTGATGCCCCGCACCAAGTGCGTCTCGCCCCCTGCTGCGTGCGTGCGTGTTTACTATACTGCAATGCTAATATAGAT
GGATGTATGTATGTATGTGAGCAGGGCGGCGAATGACCGCGCGCCTGTGGACAGGGCCAAGCTGAAACAATACATGGCCACGAAATCGGCGGCGCACAGT
GTCGGAGCGtaagacgaagaagaagacgaaggatCCTGTAGATATTTTACTTAGTTCTATTTATTTTATGGATTGCAGTCGGTCAGGCGTCGTGGTGCGT
GGCGACGTGCGCAAGGACGCGGAAGGGTTCGAGGATGTCGACGACTTTTGGGTCGATGAGGAATCCATGCAGGACGActcggtggacgacgacgacgacg
acgacgacgacgacgacgacgacgacgacgactgtGCGGTGCATTCTTCAGTACAATACAATGCTGTAGTGAGGTGTTGATGCTGATTGTTTTATTGTTT
CTGCTTGTGGACAGCGCTAACGGTGTCGGACAAGGAGTCGGCGGACACGTCGGGGGACATTTCGGAGCCAAGTGAGCAtgaggtggagctgccggagaTC
GACAGCCCCGTGCCCAGCGACCGAGATAATATGGATATTGAGACGGGGCCGATCCCGTCACGATCCAGGAGAAATAGTGCTCGTGCGGAGagggaggaga
agaaggaggaaaatGCGCCGCCCTCGCCGATGCGAAGCGATGTGTCGTTTGATTTCGGCGGCTCACCGCATGGATCTGTGGATATGGATATTGACACGAA
CGTCACAGTACGCCGCAAAAAGTCAACGGGGAAAGAtgaaaagaaggagaaggcgaagactCGGAGACGAGAATCGTTTGGTGGGCGCGGCTTTGATGAG
GATATGGCCAGCCCGTTCTCCGCGAATGAAGGTCCAGTGACTCCGCTATCGAATGGTGCGGTGTTGATAGCTATTTCCCTGTTTGCGTTGCTTGATTGGT
AGACTGACGTGTTGCCCTTGGTGTTGACGCTTTGACGCTGTAGGGAGCGATCGCATATTGAAGTCGATTCCGTCATTTTCGGACAAGAACTCACTATCAC
CAAACATCAGCAAGGAATTGTTCAAGAATGGTGAATATGGTAGTGATGCTAGTGACGAGAAACCTAAGAAGAGACAGACTaaagcgaagaaggcgaaaaa
GACAGCTACCGGCAAGCGATCAACTGGCGGAGGAAAGAAACCACGACTGCGGCCGACAGGCAAGTACGGCTACCGGACGACCCCGCCCGCTACAGATACG
TCGATCCAGTCCGTGCACACTGACGACGATAACGACGAATCTTTCGAGGCGCAGAATGACTCAGGAGGCGAGACTGGAGACGACAGTTTTTACAACGAGC
CTGATGCACCAACTGGCCCGGTTCGAGATAGGTTGCCCGATGCTTCGAGGATTttggacgacgatgatgcgGACGATGCGTGGGACGGCAGCGGCTTGCG
TCGATCGAAGCGACGGCGTTTCAAACCGCTTGCTTGGTTCAAGAGCGAGCATATGGTGTACGAACGTACTTTCGTTGGGGTGGGCACAGTAATGCCTACG
GTTGTCGGCGTGGAGCGTCTTGGTCAGGACTCACCAACGTCGAAACGTACAAAGGCCAAGCCACCGTCAAAAAggaccaacaacagcagggCCTTGGCGT
TGAAGGAGCTGCCTAAGGACGTGCAGAAGCGAGTTGTGGATGGCGAGTGGGCATCGCTCTACGACAGCCAGGCCGGCTGTATGAACGACCTGAACATCAT
CTGCCGCTCCAGCGAGATTCGTCTTCGCAAACTCCCAACTGAAGAGAGAGGTGGTGCTGTGGTGCACGCGTACGCAGGTCAGAGTTTCAACTTGTTCAGT
CCACAGCCTTTCGCTCGGTGGATTTCGGGACGCGTTGTATTGCCTCCTGGTGCGTGGAAAGAACCAGAGGGTGTTGGTCAAGCAGTGCAATTGTTCTATG
TGACGGGGTGCCAGCCCAAGTCGCTCGAGTTAGCGCTGGCGCCGGAGACCGACGAGGATTTCTTTACTAGCAAACACACGACGCACTTTCTGTTGAGTCC
GGGCGACGAGTTCTACGTGCCGGCTGGTAACGTGTACTATGTCAAGAATCACTCGAGTACGGCGGACTGCGACCTTCGGTTTACCATTTTAAAGCCTGAA
GCGCCGCAAATGCCGtcagacgacgacaactcagacgaagagaaggagacggagccGGCGACGACCGAGCCTaagcaagaagctgctgaaacaGCAAGCA
GTCCGCTCAAACGGAAGCGAGAGGATGGAGCGGACGCAGGTGcagatgctggtgcagacgcAGATGCAGACTCCGACTCCGTCTAGGGATCGTGTATGTA
CATTTCTAGCAGCAGGCTCCTTTATTCATCGTGTAATTCGTTTTGTGTGCAAGCTCTCGGTCTCTGATATTGCAGTGgatcgtctccgtcgtgACATTGC
TGTCACTGGTGTTGCACTTCGAGCCGGAAAACTGTCCGACTCGTCAGAATAGCCGGTACTTTATCCGGCGCACCATGTTTACCCCCCTCGTCGAccactg
cagcgtccacatGCACGCCATCCTGCAATccgaagcagctccagtcgaTCCTCTTTGGGGCAATTCCGTGTAAGATAATGGAGCCCTTGcccgccaccac
cacttgtCTCCTCTTTCGAGGCGCCCATTTCAACGAGCATTACACAGGCAATTGACAACCAGAGCCGTGGTGGTGAGTCACGAGCTGCAGGGCTCGTCGT
CAACTCGAGCGGCGATCTATGCTCGCATACGCATGGGCGCAGCTCTGCTACAaaagcagctggagcttcaCGACACAAGGCTTCGATGGCATGTTCGGAT
AGGTGAGACTCGCCCAGCTGGGGCGGACCTAAGAATACGCGTGGGCGTGGTTCGGTGTCTTGGTGTGGCAGTCCGCGATCGATCGTATGCATTAAAGTGG
AAGAGATTGTCACTGGTAAACGGACTGAACCTCGGACAGCCCCAAGACCAGCAGGCGCAGTGGTGGTAGGCAGACTGCGGCCCTGCCCTATACAGCCACA
GTTATTGTCGCCGCCACGAGGAGATTGCCGACACCCGATTGCATATTTATCTCGGCAGCGCATCAATCATGGATccggcagcgtcttcatcgaggTGCAT
CCCTGCAGCTCTACATACTTGGTTATCGCGATGCATTTTTTCACTGATGGATTGAGTGTTGCTACAGGATGGACGAGATCTACGAGACGATCAAAGAAGG
CAGCGTCGCGGTGCGCGGTCATTTCATGGTGTGTGAACGATTCAACGTAGCGTAGCATGATCGATAGACGCATTGGGATCTCATTAGTCGTTGTTTAATT
CTGTCAGTGGCGCGACCGCTATGTTGTTATCAAGCCGGGCGAGATGGTaattcgtcgtcgacgagaaggctCCATCAAGGCAAAGGTGCGGAGGTTCGTG
CGTCAGTACGCAGCACTGTGTAGTGCTCACGGTTATTGTTTGTCGTTTGTGGACAGATCGATCTGCTTGATACCAACAACATCAAGCTCACGTTTCTCGG
CGGGCAGTCACTGCTCACGATTTCAATGCACGGACGAGATATTGTGTTTGACTTTCGCTCGACTGTCACGCGGGACGAGTGGATCAGTGCGATTGTAAGT
GCCCAGGAGCGTCCAGGGTCCGATGTGGATTGCGAGGAGGACGGCTCGGAGCTCCTCTCCGACGACGAAACAGACCACGAAGGACACAAAAGCTCGATGA
CAAGCGTGAGTACGGCAAAAAGCGATatgatggaggaggacagcGAAGGGTACAACGACGCACTGCTGGCATTGCAGAGCGTGCGTGATTCTGTTATGCA
GTGCCATCTATCGATgggagcagcagaaatcgACACTTTCATTAACCCTCGTGAGAACACTCCAGCATTTACGAAGGCGGCGCCTTCACTTCGACGAGTG
CAGAGTGCGAAGCGTAGCGAGGAGGAACTACGACAGAAGCGGCTTCGATCTCTGTTGACGATGATCGAGAGCACGCCGCATGGTGGACGTGTTGTGCTTT
TGCATCTTGGAGTGGCGGCGTCTGCAGGTATCACAGTCGGTGACATGCTACTAGCGCTTGGGGAGAAGCAAAGGGATAACCCACGTCGTGGGTCGTTCAC
ACCACGCACTGTGAGCACTCAGAAGCACAACGTCGCGTCATTTGTTCGTGATATCCTGTTCCACCCGATCTACTCCAAGCGCGAAGAAGTTAACACGGAG
GTTGTCCAGGGACTCATCGACTTGTTCTTCCCACACTGTCGACTGAGGAGATTTAGCGATGACACCGAATGGCAGCAAGCTCAACCGGTGAATTCAGCTT
TGGCGAACAACAGGGTGACAGCAAAAAGTGAAAACGACGCCGATGTTGGCACCTCAACTAATGCTATGCCTGCTACCCCCACTGCCGTGCAGTTAACCCA
AACTCGACCTGTGGAGAGGAGAAAGCGGCGGAACCACTCGTTCCCGAACTTGGGTGGCATTTCTCAACTGGGCAAAAGCAAAGGGTTGCTACAAACTTCA
GTCGATGACAACGACAGATCCATCATCCCGAGCAATTTTGAGGAGCGCAGCCAACGCCTGAAAGATAATTTGTCCTTGCTCTTTGCTCCGATGACCCCGT
CCCCAGATCCTAGAGGCcctggtggaggaagagatgGTGCCAATTCTCTCTTGCACGCGAACACACCATCGAACTCCACATCATCAGACGAACTCGATCT
AATTTGTGAAGATATTCCGCTTCCAGTGCCTCTGCGGAGCCTTTTGTGGGAGATGTCGTGCTCTGAGATGGCTGAGCAGCTCACGGTTTTTCATCACACA
CAACTCTCGGATGTGCGTCCGTGGGAATTCCTGCACCACCCGAAACAAGCCGCCAAGGAGCTGACAGATCACTTTAACCGGTTGGTGGCGTACTTCGTTT
GGTCAGTTCTGGTTGAGGATTCGCCCAAGGAACGCGCTGAAGTCATCGAGGACATAATCTCCATAGCTCTGGCCGCTAGTGCACCACCGCTCAATAATTT
CCACTTGGTCATGGCCTGCGTGGGCTGCCTTGGTGACACACCACTGATGTCTACCCGTATGCCAACCACGTGGAAGAAGGTTCGTGCCAAATACAAGACA
CGTCTTGGGGAGCTACGACGGTTGTGTGATCACACTGGCGGCTTTGAGAACTTGCGACGAAAGCAAAGTGCCGAAAGCGCTCGACCGATGCTATCCAGCG
ATGTATCGACCACTTCGATTATCCCATTTATCGGTGTGATCGGAGTAATGCTTGAGCGATTGCGTACGACAAGTTATTTCAccgcgaagaagatgctcga
tttggagaagctcgagaggCAATACATGGTGTTGAATGTGCTTGAGAATGCACTGCTTAAACctgctccacgtccttctcgGGTACATCAGCGCGGGAAG
ACAGCTCCAACGGAATCCGCACCTGAAATGACAAAACGcttgcagcagttcttcaagacgctcaagatgGATTTTGCTACGCCTCGGCTGCATCAGCTAC
GGTCACAGCAAATTCTCGCCAACGAAACGAGTCCAGCGAGTTCTGTATCGTCTTCGTTTGTTCTAGCATCGACCatgaacaacagcagcagaggaGGAGC
CCCACCGTCAGCGAACCTTGCAGCTAGCAGATTTGATTCGCACGGCTCCATCGGTCTCAGCGAGGACTCCGGTTTGCCCTTTGTATCGTTCCGAGATATC
TGCGTCCTGTTGGTATCTGTACCTGACACGCGTGAACGAATGCAAATGGCGCTCGAGGCGCTGTTCGTGGACGGCCGGCAGCCTGCGACGCAGTTCTTGC
GCAAGTTTTGGCTTGACTTCAAACAGAATGTCTGGATCTCGGGCATTGGCCCCACGCTGCAGAGCGTTCGCCACTGCATATTTGCTGTGTATCAAGAAGT
CATGACGTACAAGATCACGGAGCTTATGCAGATCAGCGGACTTGACGAGAACTCGAGCGACCTACATGACATGATGTACGCGAagatcgtggtggtgacc
gtGCAGCCGCTTTATCTGAAGATCGCGTCGAAGGTCAAACGGAACTTCGTCAAAGAGGACGCCCACGCATCAGCTCGACTGCTACATAGCACTCCTCAAG
TCGTTGTTGACACCACCAAGCCAACCATGCCGTGGAGCAGTTGCAGCTGTAGTTCCCCAGTCGAACTGCTGGACCTCGTGTGTCAATTGGTAGCACTGCC
TCGAGCGAGCacaaccactgcagcagttgctgcgaCCGACCACCAGCTCGCAGCCGTCGAATTGCTTGGggctctgcagcaccaaggGCGCCACACTTTC
CTCGCGACGAACCCCGTGAGCAGCATGTACctgatgaagcagatccTGGACCCAAAGTACCTGCCTCTCGCGAGACGACAAGCCTTGGAGGTGTTTGTCG
CTGCAGTGACATGGCTCCGAAAGGAACAGCCTGACGAGAGCCACGTATAACGCCACCGATATGAAATCTTCCAGCGAGTGCAGACAAGGCCAGAGCGGAT
GACAGCCTGGGCGCATGTTTCCTATAAGGCCATTCTTCCCCACTGAATTTCGGAGAGATGGCCAGAATATATTATATCGCGCCGCGCGTATCATACTTCC
AAGCCACTTGGCTTGATACAAATGTGTTAGCTCCCATGACAGGCTATATACTAGTTAGCAACGCACTCTTTACATGTACCAGGACAATCGGCAAGTGAAG
GTGTCTGCAACCAAAAAGTATCCTTTGCGCACCGTGCATTTACATAGCCAGAGCGAACGTCCTTTCGTCCGCCAATAGAAGCGCCGATCTTGACGCGCGG
TGATTTTACCCACTCGTCTCGCTCGATTCCGCCGTTTCGCCATTGGCCGAAATCGCGCACAGTTGCACATTGAACCGGAGGGCTCATCTGACCCATTATG
GCTTCGTCACATTGTCTTCCTGCCGCGGAACGCGCCGCGCACTCGACACTGCGGGCAGGCGAAAGGGGGAAGGCCGGCTTTATTGCCACTCATACACCAC
ACCTCGCCCAGACCTCCCTCCCTTCTCATCGGCACCGGCATCGCAACGCTAGTAGCGACTAGCGAGGGGCGTGTACTACGTCTTATAGCAAAGCCTCCAC
ATTCTGATACGGAGGAGCGCCCGGCCAGCGGAACGATCCGCGCTCTGCGACACCAACCGGTGGGTACTGTAGCATACACTTCCTTTCGTCGGTTCCATTT
CCCTAATTCTCCCTCCTTCAGGCTCTGTAGATTCTATGCGTGCGTCGCTGGCGCTCGgcgtcttggtggcgctgctggatgtggctTTGGCTGCCAGTTC
TTCGGGCTCCAGCGCGACGAGCGGGACGTTGAATACGCTGACTACGAGCTGCAatggcggctgcagcagcaacggagcGTGTGTGGTGGTGGGCCAGTCG
TCGGCCAACTCCATTAATTGTGTCAATGACACCAACTGCGTCACGCTGTCGTCGGGGCAGTCGGCGCTGTGTCTCGACGCtttcagctccagcgccaccg
agTGGATCTTCCAGCCGGCCGAGAGCAACGACACAGCAGGCGCCGGGCCATTCGAACGcgtggggctgctgcagctggatgaTCATGTGACAGCACTGAC
GTTCCAGAAGGCAAATGCAGGGGAGGAACCGCTCACTGGATCGCTGCAACTCGCCTCTATGAACATCCAATCGGACACCACTTTGGACGCCGTGACATTC
CGGAACTTGAGTCTGTCCGGATTGGACAGCGCTTTGCCGCTTAACAGCGTCAAGAGAATGTGAGTTGCTGTGTTTGTTTAATGGGGGAGGAAGGAGGAGT
TGAAGTCTGACAAGTTGCATTTAAACAGATACTTCAACAATTGCTCACTAACTGAGATCCCTACAGCTGCTGTGACTGGAGACTCCGTCACTGTCATGTA
AGCTGTTCTGTTAAACGCTGGAGGAGTGTTTTTTTGTCTAATCGTGAGTTGTAATGCAGTGACCTAGCTAGTAAcatcatcaccaaggtgGACACCAACT
TCCAAGGGAAGACTTTCAGCAACCTTACCTTGCTGTACGTGGAATCACCAACAGGCTCTCCGAGAAGTAAGCATTGCTGACTTTCGTATTTTTTTCCCTG
TCAGTGATTTATCCTCGAACGCATTGGGAGAGTTCGATCTCGTGGCAAATAATGTTCCTGCCATCACGACGTTGTGAGTATTATTGCTTAGTCCTGTACC
ATATTCGATTCAAATCTTTTCCTAACGTTTGTTCTTGTGTGCTTGCTCAGATATCTCAACGACAACTCGTTGAAAACGATTCCTGACGTGGTCTTTGATC
TATCGACTCTGCAGATCCTCACATTGGCCGACAACCCCATCAACGCGTCAGATCTGACATCGCAGCAGTACACATTTCTCGCTAATTTGCGCATGTTTAC
GATTGATGGCACCACCAACACTAGCGCATGCCCGAGCACTGCAGTTCAGAGCGCGTTAAATGGTTCCTTCACATTCTGCGTGGGGAGTGATGACGGGTCG
AACACCACTGTTACCgagcagccagcgacgacagtcCCGTCAACATCAGAGGGCGATTcctcatcctcttcatcgaACAAGACATGGATCATTCTTGGCG
CGTGTCTGGGGGCAatcgtgctgcttctccttaTCGGCCTGatttggtggtgctgccgccGGCGGAGAAATGAGCAGCCCAAGCTCATGAACAGTACTAT
ACCTTCAATTGCGATCGGCATGAGCGATCTGTCGGACCATCCTTACATGGAGCTGGGTGTGCCGCGTTCTAACGCGTCCAGTCAGACGACATCGgacttt
gagctgcttgcgtcTGTGGCGGACGGCTACATTGGGCTGACTCGGTTGTCCTACGATGATGTCTTCCTGcacaagatgctgcgtgtTAGCAGTCGGTCCG
AGCTGTGGCTGGGCGAGTATAGGCATGACGCTGTGCTCGTGAAGAAAATCAAGAGCAACACGGCTTCAAAGGCATTGCTACGAGATTTCGTGACGGAGAT
CGAGCTGATGTTCGAGCTTAAGCACCCTCGCATTGCAGCCTTCCGAGGGGCTATGTGGGACGCAGATGGAACGGAACTTTGCGCAGTGGTCGAGTATGTG
GAAAAGGGTGCTCTGCGAGATTGCACAGTCAACAGCGCCATCGAGTTATCCGTACCAAAACAGCACGCTATCGCACGACAGATTTCAGAAGCTATGGCAT
TCTTGCACAAGCAGAACATTGTCCATGGCCGATTGAATGCATTCAACATCCTGCTGGACAAGGACTACTCCGCCAAGCTGAGCCTCTTCAGTATCTTCCA
TTATGTCAAGCTTTCCCCTCTGGACAACGAATGCAAAATCTTTGTCGCTCCTGAGGTTCTACGCGGCGAGCAGCCAACAGAAAGGTCCGATGTCTACGCA
TTCGGCGTGGTACTCGTGGAGATTGACACCGGTGAGACGCCAGTGATGAACGCCCGGAGATTATCGATGGAGCGACCAGATAGTAACTCTccgacagcga
agaagaccgGATTCCGCTTGACGCGTCTCTGCTCTGGGGTGATAAAGGAAACCATCGCTGCATGCCTAGAGAAAGACCCTGCTCGGCGACCGTCGATGGC
CGATGTGGCGCTGGCTTTCAAGAATGGCGCGATGAAGCTGTAAGCTCTCGCTTGGAAATCAGCACAGTCGTGACACGGGGCGCTCTTCCCAGATCGCTAA
GTTTATTTTGTTTTCTACGGAGCCACATGCCAACTAGgcccgacgctgctgctgcatcaagcAGGTTTGATGAGAAGTTATTAACTCGAGTAGATGTAAA
CAGCAATCACAACTCTAATGTATAAAATCAAATGCAACATTTGGCACGCTTTCAGAACGATCGATTTCGACCTTGTCAAAAATGCGACGCGACAAGAGTT
CGTGTTAGCAGATGAAGTCCACCCCTAGGTCGTTGATGCGGCTTAAACGATGTAGGATGGACTTCATAATATGCACGACAACGCCAATGTTTCGTGTAGC
ATCTTGTCAGGTTGTTCAAAAAGCCAATTGGTACGCTGCCTTGAGCATCACGACTGTCTGATCTACATGTGTACTTGCGCTTAGGTTAGTCGTTCTCTTG
TTCTCTCGTTTCGCTGCTTGAAGGGAATCGCCGCATCTGTCGTCAATCTCGTTTAACATTGTGGTCATCAAGATACATGTATTTCACGGTTAATCACAGC
GCGTTAGCCACACGAGTTGCAGGACAAGCCGTACATATTGCAAGAAAAAAATCGATTGCCTTTTTTCGAAGTGCGTCAAAACTATCGTGACAATAAATAT
TCAACGCGCCTCCCTACTTCTTCAATAATATCCCCGCAACGAGCCTTCAGTGTGCGTGGAGATACTGAAATCTTCCTATTCTCTATGTGCACGCTCGCAA
AACAAGCGGGGGCCATCATCATCGCTTCTCGTGATTTTGCAAAGCACCAGCGTTCGCAGCTTGATGCAGGGAGCACACGTTGCCATTGCGTTCGTAAGCT
GGCTTACGGCATCCTTCCACGACACAGCGCTTGCCTGAAAAGAAGCAAGTGATAAGCAACAGGTACAACAAGGGCAAAAGCGACAAAAAGCGAAAAGGAA
GAAAAGCTTTAGCGCGTGAGCACCCCCAAAATGTCAAGAATTGCACGAAAAAAATATGCACAGGATATGCAGCTCACCTCCTCCGTGCGCCCAGCAAAGA
CCATGGGATACTGCAGTCTTGGTGCAGTTTTGTTCGCTACATTTGCGACCTAAAGGAGAGAATTTGAGTTAGGAAAAAGAAATCAAATGAAAGAGATCAA
AGTGAGCTGCCGAACCTCCTCCGTGAGACCAGCAAACTCCGCGAGACTTGGCGCGATTCTCGCACCCCGCCACCGTGCACTTGGTGGAGCCACCTGCAAA
ATGTTACACAACGATGTGTTAGCAAATCATGAAGCCACCTTTTTCGATGATCGAGTCTTGCTTACCGTGCTTCCAGCACACGCCCAAATTTTTAGCACTG
CTCGTGCACCCGACGACAGCACATCGCTTGCCGCCCTGTTATCAGGTTGGTCAATTGCACAGCGCATGTTCAACCGTTAGAGATCCAAAAAGCTGCATTA
AGTTCACTTCCCCACCAGGGAGCAAAAACTTACACCATGACCAATACAAAGTCCACGGTTCACCACGTAACGCGTACAGTTCTCAAACTTGCAAATACGC
GATTTTTTCACCGCAGCTTTCGGAGCAGCAACCGCCGGCATCGGCACATTGGCAACCCTGTTCTCGGAGGCGGAAACACTTGCAGCAACCGTGAGATCAG
CTGCAAAACGGCAAAAAAGGAATGAAGCCAGCAATAACGTGATCAGTCCGTGCCCGACACGGAAGTCCCCACCAATGGCTGCAGTTGCAAATCTAACCCA
GTCAACGTACCGAAACTTACACCAGTCGAAAGACTCTGGTCCTCGCCCAAGATGAACGCGAGTGAGCTCTTGCTGGCTGCAGTTGTATTTCCCACtagcg
cagcagccgcagccgccGCGTCCTCCGTGTTCATGATAGCTGCCAGTCGATGGCGATTGCCATtgagctgcaattgcaacgcCGGTAGAGCTTCTGCATG
TGCGTCCTGCTTGGACTCGTCTGCCGCCACTTGCTGGAGCCACGCAGCGTCGTCCGAGTTCTTCATGCAGGGCTGTGAGGGCTTGGGAGGATCAAAGAGC
AGCATTCACTGGGGCTGAATTGATGAGAAGGGACCAAGTGGTGTGTGGGATTGGGGGTCGAcgagggggggggggggggggggcacTGACGACCACAGCA
CAGTACTCGACTGACCGACTGTGAGTGAGCAAGTGTATTTATATTCCTACGGACTGCCAGCCAGCAGTCACCAGCCGATTGTTATGTGAATAATGGAGCG
GGTGTCGGCCGCGTCTCGGAGTACGGACACTTTGGGGAACAGCTCAAGTCGCGTCTGTATAGCGCACGAGAGACAAGCCGAAGCTGATTGCTCTGCTCTG
CGTCACCACGCGAACCACTGGTGTCCGCCGCTAAGGGATCCGCTACTGCGCGTCCGGCTTGCCTGCacttggactttgtatggGCTTAACGGATGGTGGC
TAAAATTGACGCCATTTCGACCAATCCCGTCGCACAAGTACCGCACCCATTTGAGCTTCGAAATCTCGCCccatagtgaaaccaagtgaTAAACGGCATC
GACTTGTCTCTGTCCTGACCCCCTGTAGCATTGCGCTCCGGATCGCTCAGAGGCCCAGTTCAGCGTGACAggctcttcatcctcgtgcTGGGCTGCCTCG
AGCTGAGCTTGCTTGCCTCCTCAGCGGACTGCGGTTGGAAATGCATGTTCATGCTTGAGGGCTTGCGTTTTTTCGATGCCTGCATGGCCCGATACCTGTA
GCTGCATTCAAGCAGCGAATGATTAG