Description :
From Genome Similarity Track
Location :
Scaffold_642:3446- 4448
Transcript NameFunction/comments
g16768.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
TAGCCATCAAGCGACGACGAATCTGAGGATAGCGATTGATTCTGATTGGGTTGTAGCCAGAAAATTTCATTCATTGCAAATTTCATTTTGTTCGTTTCAG
TATAGTGTAGGGTAGTAACGTTTAAGTCAAATTTCTTTCTGGGGTTAAAAAATTATCTGTGCTGCTTACAATGCGGTTTCTACTAAATCCGGATAATATA
CCACAAAGAATTTTCTGAAGCTCAATAACTGAAAACAAATGACATTCGTGCGCTATCCTTCCAATATAGAGCGCCTTTGCAGCTGACGTCTCCGTCGGCT
GCTCACGCTCGCTAACATGCGTTTGTGTTCTCTCGTTGGAGTCTTGCTCACTTTCAAATTAGCCTCAAAGCAGTCTACCTATAGACTAACCGCTCAAGTT
CCAACCGATCCAGCCACAACAGAAGCCTCCCACCACATCAGCTTTCCGCATCTTCCCTTGCTGTCAAGTTGCTCCGCTTGTTGTGACCCGCTAGGCTCCA
TGCGCTCGCGTAGAGCTCAAAGAAGGCATTCCCGCCGGTTGGTGTCAGCTATCAGCAGCGACGTCCCCAACACTCAACCGGCGACGGCCGTACCCTCGCC
ATCACCGCCCCGTGTCAGTGATGCTCAAAGTAGTTCACGGCGGTCACTGTCGTCAAGCAGCAGCGACATTACCACGACTCAACCCGCTACCACTGTGCCC
TCGCCATTGCTTCAACGTGCGAGTGAAGATAGTAGTACACCGACTCCGACTAGCCAACCTGTGATAGCTTCGTCATCCAGCGAAAGCGAGGACTTTGCAT
GTGAAGTAACCCCGCGACGACAACCACCTGCATCAATTGGAAGCAGTGGCAGCGGCAATGAACTGTTGCAGAGCCATACAAGCGCAAGTGCTGCTGACCT
ATCGGCTAGTGGCAGCAATTATTCGTACGTGAAGAACACGAAGGTGTATCTCTCGTAGCGAGCTTGGAATCCGGATCCAGCATACCTCACAGTCGAGAAG
AG