Description :
From Genome Similarity Track
Location :
Scaffold_32:344533- 347514
Sequence
2981 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGCCCGTCCAAGGACCACAATACCCGTTCAACATGAACATGTTGGACGATGAAGGCGGCGACACCTTTCACGGCA
CCCGTGAAAATTACTCCTATTTGAGCGCTGAATGGAGTGCGGTCGAACGAATGAGTTCGACCGTTGGCGAAGAAGCTGTCTGGTCTCTGCTATCCTTAAA
GAATAGGGACCAACAGCATTCCATTATCGCCAAGTTCTTGCAGCGAGAACTGACGCGTCGCGAGCTGAAGTGACCCTGCTGCATCAGCACGGTCACCAGC
AGACTGATCTCATAAGACAGCAACAGTCTCAGTCTGCTACTGCAGCGTCGACACGTAGGCGTCGACGCGAGACTCTAAAATTAGAAGTCTCCAAGTACCG
GGGAGTTAAGGAAGACTCCCTGTTCAGATGTTTCCTCGAAGTGAACGATGCCATTAAGGCTCGCCACATCGACGATGATTAAATGCAAGTTGCATTTGTC
AAATCGAATTTATCAGGGCGTGCCAGAACTTGGGCTCTGAATCTTCAATTACACGATCCAAACGTGTTTGGATCGTTGGCGGTTTTTCAAGCCTCTTCTC
AGCCAAACGTTTGAGCCGCCAAGAGCTGATTTCAGGACTCTTTCAGAGCTCCTGAAGATAAAACAAGGTAAGCGTGACGTTCACGCTTACGCTCAGCACA
TTCGTTACCTTGCAAGTTGCATGGTAGCGAATCCTGTAAGTGAATTCGTGTTGATCACGATATTCTTACAGGGCCTCATACATGGTCCCGTGATGAACCA
CCTATTCTGCATCGAGTTGAAGTCGCTTGAGGAAGCGATTACAACTGCGGTACAAGAGGACTTTAGCATGAGACAGGCTCACACTAGCTTTACCCCCTAT
CGTCCTTCGAGACGAGTAGAGGCGGGAGGTCCAGAACCAATGGAACTCTGTTATGTCGAGAGCGAGAGATCTCGCTCTTCAAGCAGTAAGCGATTGCAAA
CGTGCAATCACTGTCAGAAGTTAGGACACTACGCCTACGAGTGTAGTACTTCACGCCCAGTGTCTCGTAACACTGAGCGAAGTGATCGACCGTCTGCCAG
GGAGGGCAACGGACGCGGGTCCGACGCTGTTGCAAAGTCACAAAAGCGTGGCAGACCGTCAAAAAACGGTCGGGGTCAGTAGGGGCGGAGCGCCATACTG
ATCCAGCAACCTCAATAAAATTTGCAAATCTATTGATGAAAGTTGCTCTATACTCACAATCCTTGTTTGGCTCTGCACTTGGTGATGAGGTACCCCTCAT
CACCTTGAAATTGGAGGTGACAAAAGATTTGCCACTTCTTGCCTTAGTTGACTGTGTGGCGTCGAATAATTTTGTTTCGTCGCCAGTCGCTAGAGGATCG
TAGGCTCAAGTTCGTTGAGCGCGACATCCCTCCAACGAAGATGACGGTGTGACTTGCCACAGGCGCTTCGATTACCGTTGAGAAACGTGTAGTTGGAATC
CACTACACGTTAGAGGGAGAACAGTACAATGATGATTTCATCGTACTGGATGTGGATAACAAATTTGATGTCATCCTGGAATTACCTTGGCTCACAAGGT
ATGAGCCAAGAGTGAGCTGGCATCATCGATCCGTGAAGATGCCTGCCACTTGTTAATCAGACGGCCACCTGATGAACGTCTTGGAGCGTCCACAAGCGTG
TGGATATACTCCGAGTGAGTGCAATGGCCTCACTTGCGGTACGGTCGTTAGTACGACTGCACAAGATCTCAGTGTGACAACCAATCACACTGTGGAGCAA
GCTCCCGGCGGCTGTGCGGATGCACAGGCAGCGCCGAGGTCCAACACTCGAACAATTCGAGTGGATCGGGATATGGGTGTACGCCTAGCGGGTGACATCC
AAGTAAGAATAAACCAGATTCCCACATAGGGCAACATTATGATCCTAGATTGGCTGGAGAGTCGATCGTAGAGGACCTAGCTGTGGTAGCGCAACCACAT
CTAGAAGACGTCGAGGGAATAAGTCCCCAGCAGCCTGTGGAAAAGGGTTCCCAGGAAGAAACCGAGACATTGAATGTCTGGGTTAATGACGGATCAAGCG
TAGGTACTTATACGCTTGATCTGGTTGTGCCTCCGAAGTTGACTTCGGAGATCACTCAGTTGCCAACGATAGAACCGAAACGATTCTAGCTAGATCTGCG
TAGTGGCAAAGTCAAGCAGATCTACATACTCGTCACAGAGGATGAGTATGTAGCCGATATTTGGTCGGCAATAGTATTTGCTGAGAACGAAGGGGTTTAC
AGCATCTCATCAATGGATGAAAGTGTCCTAGATGAGAAGACTCGGATTGAACGATACACGTCTCAATCTTGGGAGTCGCTTCAGGCAAATCCTTTGTATA
AGGATTTGATCGAATTCAGAGATGTGTTCCCTGAATCCATGCCATGCGAGTTGCCTAAGGAAAAAGGAACTCGACACGAGATCGAGCTCAAACCGAACTT
GAAGTACTGTGTCATGAAGCATTGGCCACTGCCTCGTGAACAAGTACTTGCGATCGACAAGTTCTTTGCCGATCGCTTTGCAGCGGGCCATATGAGGGAA
TCACTTCCCCTCACAGCTCTCTGACCTTCTGTGTGCGAAAGACCACAGGAGGATGGCGGATAGTGCACGCAAGTTGAATGCTGCTAACGGTACCGGTTCA
GACGCCGATCCCGAGGAAGGACGTAATCATAGATGGTGTGTAAAAAACTACCATCTTCTCGTCCATGGATCTGATGGATGGCTTCTATCAGATACTTATG
CGTGAATGGGACATCCCGTACACAGCAGTGAGCACCACCAGCGGTTTGCTGTGGGAGTGGCTAGTGATGCCACAGGGGCTGAGTAACGCTCCTGCAACGT
TCAACAGATGTGTAACACATCTGTTGAGACCGGTGCAAGATTTTGCACCGAGTTACTTTGACGATGTATTCGTCCATAGCC