Description :
From Genome Similarity Track
Location :
Scaffold_43:344427- 345658
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012509Protein of unknown function

Sequence
1231 bases(100 bases per row)
ACGTGTAAGAGACATTTTTTCAGCACCAGCACAAAGGATGAACCAATTTTATTTTTCTGAAAATGACAACATACACAACCACAATCCTATCGGCACGAGA
CCCATATCGCTACTGCTCACGACCGCACTCTTTTTCTTCAGAGCCCATGACGATATCTTCACACAAGCCAAATCCTATTGTTGGAAGTTGCTGCTGCAAT
TGTGAACACCCCTATCAGCATTATTAATGTCTTACTCTCTTGTAAGAAGCAGTAGAAATGCCGGGAATGTGTGCATTGCTACAGACAGCTCATCATGTGC
TTCCTGCTTGCTCTTAACAACATTTATAGTCAACTCACACTCTAGCTTTTCCGTTTTAAAAACCATGTGTAAGAGCTTTGCTACATTCTGGTCAGCGCGG
ATGAAGACGCGTTCTTTGTTCGAGTCAAGAATAGTGACTCAGTGCGAGACCTGAAGGCGGCCATCAAGAAGATGTGGAAGAGCAAGATCAAATGCGAAGC
ACATGAATTGCGTCTGTATCTGACCAAGAGGGGCAACAAGTGGTTGAATTAAGCGGAGGCGGAGACTGTGACACTAGCAGATCTTTCCAGCATTTTGAAA
ATGACGGCTTCATTGCGCCTGAATGCCGACACAAACTTTGGAAAGGGCTTTAACCACGGTTATGGGGACACTCATGTCCTGGTGGACTTTCGAGAACATG
AAGAAATTGCAGACGAGCGAACCTTTTCACCAACGCCACTCCACCGCCATCCCGAGCGGCTTAATCGATAGGCTGCGATCAATGCCTTGATTCGACGGAA
GGTCGAGAAAGAAAACGCGAAGACGAATCATGGTATCGGCAAGAAGCGAAAGAACAGGGATCTTGATACCACTGTTCCGTATTCAAGTTTGTCATGGAGC
GACATTGAACCTATTTTGCGAATGGAGTCATGCACCCCTAATTCAAGTACTATCGCTGATGACGATGTCAAATCGCTGCACACTCGGATCGCGAAATTGC
GCGAATATTATGGGGAGGTGCATACTGGAAAAGGAGTCAAGCGTCTAATGTTCATCGCAGCAGTTATTGAGACAGTATGTCGTCTTCTTGGCGATGTCAA
GATCCTGGTCGAAGAAGACGTACATGGGAACAACGTGTATGTACATGGTCGCTTCGAGTTTGTCCTCAAGCGCAGAGATAAGAGGATTTCGATTGTTGGA
GCCAAACGTGATGATATCGAGCAAGGTATGG