Description :
From Genome Similarity Track
Location :
scaffold_60:34442- 52237
Transcript NameFunction/comments
g2419.t1hypothetical protein

Sequence
17795 bases(100 bases per row)
GTAACTAATGCAACCACGTTTAACTATGAACGTCAGCAGCAGTTGTCTGTCAGCATATGTGTTCGAGATGGGGGCATTCCACCGCTAAGCGAGTGCGGAG
TCGTTACAATCTTCATCACAGATGAAAATGATAGACCAGCAACAATTTCACCTCATACATGCCGGCTGGACGAGTATTCATACAATTTGAATGACAAACA
GCTTGGTCAATTGGTCGGTGCAGTGGTATGCAGCCTTTCCATAACAGATGAAGACAATAGCGGGTCATCTAATGTTTCGTGGAAAACTCACGATTGGAGC
GTGGTGGGGTCTGATTCGGGATGTCCGTTTACCATTAGCTCTCACGGTCAAGTTTTGGTGAGATTTCCCCATCTTGTTGATTATGAAGAACGTAAAATGT
GGTCGATCCAGGTACAAGCAACAGATTTTGGAGGGCTGTCAAGCCCTCCGCAAAGGATTGACATCGTTATAGATGATATCAACGAAGATCCGCAGATGAC
CCCTAGCACATTTTACATCGATGAGAACTCACTGCCTAGTACCCAAGCATTGGGAGACTTCATGATTGTAGATCCAGATATACGCAGCGATGGTCAGCCC
GATACTGTCGTTGTCACGTTGGTTGATAAGGTTGACTTTTTTGAAGTTGTACAGAACAAAGTTCGATTGGTGCGTGGTGGGCTAGATTTCGAAGTGAAGC
CATCGTATACCCTCTATGTTGTGGCGACAGACGCATCTGGGGCAAGAAGCAGCCTTCAGAGCGTCAATATTGTGATCAACGATGTTAACGAAGTCCCATC
GATTGACACAGTGCGAGTTTCCCTATCTGAAAACCAACCTATAGGAACGAAGATCTTCCCAGCCGTTTCGGCAAATGATCCTGACGGGCTTAGTGTCTTT
TTCAGTGTGGTTTCTGAGAACCCAAGTGGTGGTGGTGGTGTGCGAGCTCCAAGTACATTTGAAATTGACAGAAAAACTGGCGTTCTGTTCCAAAACGTGG
ACAAACTGGACTACGAAGGAATAAACGAGTACGATTTGGTTGTGAAGGCACAAGATAGTGCCGGTCTGTTTTCGACTGCAATTATCACAGTAAGAATTAC
TGATATCAACGAACCACCTCGATTGAGCGATCAGATTGTAAGTATCCGAGAAGATGCAAGGGTTGGATCTCTTGTCGGCCAGGCATTTGCTCTAACTGCA
TACGATCCGGATTTGGGAAATGGCTACGAGATACTTTCGTTTGTACTAAGTGATGGGAGCCACTCTATGTTTTCTATCGACTCCAAAACGGGCCAGGTGA
CGACTTCTGCGGGTCTTGATTTTGAAACAGCTTCCATCTACAATTTACGCGTGCGTGTTATCGACTATCATGGTTTATCAGGTGAAGCTGATTTCATTGT
CAACGTTATCGATGTCAACGAACCGCCATCTATTAGTGCTTTTAATATTTCTGTACCAGAGGATTTGATACCAGGATCTTCTATCGGCTCTCCTATCCTA
GCATATGACGAGGATAGAGACTCGAAACTTGAGTATGATCTTGTTGGAACTAGTGACGCTATCGCGGCTTGTATCGGAATTTATTCCTCCACGGGGCAAT
TGATTTTGAAAGTTAACTGTGCACTAGACTATGAGTCCTCTTTTGGAAGTACGTTAACGATCGTGGTGCGTGTGTCGGATGGAGAGTTTACTGTATCTGC
AAGAGGTGCGGTCTACGTTACTGATATCAACGAGCCACCTGTCCTTGTTGCCTCTGTACTGTCCCTCTTACAAGAAAATGCTCCTCCAGATACTATTGTA
ACTATTCTCTTGGTTGAAGATCCCGACGTTAATGAATATCATCAATTTTGGGTCTGTGAACAAAGCAACACTAACGCCTTTAAGATCCAAGCAACAGGTC
CGAATACCGCAGAAATTGCTGTGAACAATTCGGCTGTGTTAAACTTTGAAAAATTCCCGGCCCTATGGGTTGATGTGTGTGTTCACGATAAAGAAACTTT
GATGGCCAGAGCTCGGTACACCATCAAACTCGTGAATGTATTTGAGCCCCCGTATTTCGCACAACAAATTATTCAATTTGCTGTGGAAGAGTCGACTCCT
GTTGCGTCAAAAGTAGGTTATCCGCTGTCACGCTACGTTGTCGACGAAGAGCACCTGAATACAGCCGTAAGTTGTACAGTTGATTTGAAAATTGTGAACA
CCACTTGCGGTCGTGGTGCAGCTTTTACTCTGGATGGGTGTGGTCTGATTATGCTTGGATCTGGGTCATTAGATTACGAAACGATGCCAACGTGCGTCAT
CTACGTCACACTTCCTGTTACAAGCCTTTACAACTCGAATAATTCAGCCTCTTCGCTACCTGATACGATTGTCGTAGTTTTGACTGTGATTGACGTCAAC
GAACCCCCTTCCTTTTCACAAAAGGTGTTTCAATTTGGCGTTTCTGAAGATGCTGCTAGAGGCACAATTGTTGGTTATTTGAGTGGCACTGATGCGGATA
TTGGTGATATTATCTCGTTTCACTTATTAAAAGCTTTTGGAGGAACATTTATGGTGTCACCCTCAGGTGCAATTACACTTCAAAACTCGCTGAACTTTGA
GATAACGCAGTCGTACCAACTTTCTGTCCGCATAGCTGATAGCAATGGGGCTTTCTCCGATGGAAGCGTTACAATTAGTGTTACGGACAGTAACGAGCCC
CCTGTCTTTCAAGCCAGTACATATACCTTTGGTATCGAGGAAAATGTACCGGTAAACACCGTTGTTGGTTCCGTGACTGCTATTGATAGTGATACGTACC
AGAACAAGACCATATCCTACAATATTGTCGATGGAAATGACTATGGTGCATTTGGAGTTCTATCGATAGCAGGAGACGGTAGAATTATCGTAGCTTCGCA
GCAAGCTCTCGACTTTGAGCGCCAGAAGCAATATTCACTATTAATCTCAGCAACCGACAGCGGTATAAGCGGGCTCTCCACTTTTGTGACAGTGGTTGTG
ACTATCAAGGATATGAATGAAGCTCCATCAGCAAATCCTTTGACTCTCTACATTCCTGAAGATGCTACCATAACTACCGCACTGTACACGACCCAAAATC
TCAACCAGATATTCACGGGAACGTTTTTTGCCTCAGATCCAGATAGTAACGACATATTGACGTTCACGATTCTTGACACGACGGATACGTTTGCTATTGA
CCCAACCACAGGTGCTGTGTTATCCCAGAAACTCCTGAATTTCGAGCAAAAACCATATTTTACGATATTTCTATCGGCATCAGATAGTGGCAATCTGTCA
TCGGTGGCGATGGTGAATATCATGGTTTTGGACCGCAATGACGCCCCAGTCATCTCTTCCACGGCATTTCTAGTTGTTGAAAATGCAGTTCGAGGTTCGG
TTCTTGGTGCCGTGGTTGTTACAGATGAAGATTACGACCAGAAGCATGTTTTCACTTTGGTTGAAACCACACTCCTGTTGTGGGATAATTCGTCGAGTAC
TAGTACAGATGCGGTTTCTGTTGATTTCAATTCTGGTTCAGTTCGTGTTGTGAACGAAACCATTTTCGATTATGAGATGGTTCGCCAGGTGATAATAGTG
ATAACGGTGAGTGACGATGGAAACCCTATTAGGCAAACGACGAAGCCATTAATACTTGATCTGGAAAACGTGAACGAGCGGTGTTTCTTCATTCAGCCGT
CATTCGCATTTTCGATGTCCGAGAACAGAATTGGTATGGGTGGACAAGTACTTGCAATTGATCCAGATATCAACACGTCGCGATCGTGGGGCTCACTGGA
CTACTACGTCATTGATATCGAAACGTCGAACTCTGTTGTTTCACTGTCGATTGAGGGTAAAGTCCTGGTAAATTCACCTTTGGATTTTGAAACTCTGCGG
AGGGTTTCGTTTAAAGTTGGAGCAGTTGATGGTGGCGGCTTAACCTGCTCAGCTACTGTGGAATTACTGGTTGAAAACGTGAACGAGGCTCCAACTATAC
AACCAGGTCACTTTTGGGCGCTAGAGTCAGTCGACGGGAGTCTGGGTCCGGTAAAGGGACTCGGTGAAACCCAAGCTCAAATATCATTTTGGGACCCGGA
AAATGACTCAGTGACAGTGTCACAGAATTCATCTGACTCTTTTTCAATCTCAGGCGAAGGGGTAATTACTTTAGTGAAGCCAGTTGACTATGAAGCGAAA
ACTTGGTATGATCTTCTAATTATCGGTGTCGACTCTCATGGACTCCAGACGAGCTCTATAATCCGCGTTGATATTATAGACGTGAATGAACCTCCAGTTT
TTGTTTCACCCCAGCCAATGATGGTTATTGCCGAAGATTCTTCAAGAGGTGCTATCGTTGGGGCAATTGCTGTCGCGTATGATCCTGACGAATTTGATGC
TATATCTTACAAAATTGAATCAGTGACAGACCTTAACGGTATCTCCGTGGATATCTTCACGATTAGTTCATGCAATGGCGAAATTCGGATGAGCATGTCG
AACGCTCTCGACTATGAAACTAATAGTGCGTACTCATTAACTCTGAGTGCAACAGACCGTGCGGGTTTACAGACGTTCGCTGAGCCTATTAACGTGCAAA
TTTCCGATGTTAACGAGATGCCCCAGTGCCGCAGTACTACCTTATCGATAGCAGAGACTGCGACTGCAGGTGAAAAGTTAGGCCCAATTATGTGGAACGA
TCCGGATTCAACCAGCAAAAACAGTATAACGGTATTTGAGGTGGACGCTGATACTGATGAAGCTAACTATCAAATTTTCGAGATTCAGCAAATTAACACT
CAGTACTGGCTCGTACTCCAGCATGGGGGATCTCTGGACTTCGAGTCTGTAAGTCTTTATAACGTGCACGTTAAAATTGGCGACAGCTTCGTATCCAGAA
ACGAAAAGACTGGATCAGCGACAGTATCATCATTATCTTCGGCTTGCACTATCACAATTCATGTACTCGATATCAATGAGCCACCTGCCGTTGAAACTGT
GATCAACAGAGAAATTGAGGAAAACTCTCTGATCGAAGCACTGGTAGGCCTACCAATTGAAGCAACGGATCCAGATACACAAGACGTTATCAATTTCGCA
ATGGTGACTCGAAAAGATACTCTGATTCCATTCAGGATTGACTACAAAACGGGCCAACTTTATGTATCGGGGGAATTGGATTACGAAACGCAGGCATTGT
ACAGATTCAATGTTACGATAAGCGATAGCGCGCAAAATACTGTCACAACAGTGCTCCAAGTCTCTGTTCTTGACATCAACGAGAGCCCTCTACTGTCACG
AAATTGCTTTGTCCGCGAAGATGGCACCTCTGAAAATCGATACGAGAATAACAAGCACGTGTGTCTTGAAGCACAAGAAGATATTGCACCTGGAACAGTG
CTACACCACTTTGAAGCTTTTGACCCAGACAGCAACCAGCGCTTATTTTATCGTTCGGTTGACACGGCTAACCTGATTTTTCGAATCGTGCAAAATGACG
ATAGAAGCTGTGAACTTGTGTACAGCCAAGCCGTCTTTGATTATGAAAGCTCACGTTTGTACCGTTTACAGCTAACAGTCACAGATACTGGTAAAGGTTT
TCTGTCTGATACAGTCATGGTATTTATCTTTGTACTGGATGTTAATGAGCCTCCAGTCCTGCTTCAAGTGTCAACGTTCAGTCTTAAGATAGCAGAAAAT
CTGCCACGAGGACAGCTATTGGGACAACTTCAAGGTATAGACCCTGAAGGAGATGAGTTCCGGTTTTCGCTAAAGGATTCTAGACCAATTGCAAATGCTG
TGGAGATTCACGCGGATGGGGCGATTTTTTCAACTGAAGTTTCTCTTGACTACGAAGTGTTGGCAGCAATAAATTCGGCCTGGTCTGAGCCAACCCTGAC
AATTCGAGGTGAAATATCTGCTTTGGATGGTGCTCTAACATCATTTAATTTTTCAATGACTGTGGTCAATGTTCCGGAAGCTCCTGCATTCAGCTCAGAT
CACTACGAATTTGCTGTTCATGAGCTAGCCACTACTGGAACGATCATTGGAGTGCTCCAAGCAACTGATAAAGATTTAAACGATACACAACAATTCGAGT
GGATGACGTCTGATGGAGATACTAGTGCTGCTAGTAACTTGTTTCAATTAAGCCAAAAGTCTGGGGTCATCACGCTACTTCGAACAGGGGTTCTGGACTC
AGAGCTGACTTCATCTTACCAGCTCAAAGCACATGTAATTGATTCAACCGGGTTGACAGATTCTATAACCGTGGTGATATCAGTTGTTAGTGATAACGAG
GCTCCTACCTGTCCTCCAATTCAATGTTGGGTTATTGAAAATTCTGCGGGAGTCTTCCAAGGACTTCCAGGTAGTCGAGGGGGATGCCAAATCGCAGTGC
AAGATCCAGACATTGGACAGAAGCACACCTTTCAGTTGTTAGCATCTACCGATAGTCGTCTGTTTTCGATCGACTACGCAACTGGGGTGGTAGAGTTTGC
CCCCGATCAGCAGAAATACGCCGACTTCGAAACCCAAAGTGAATTTCACCTTCAATATCAGGCGAACGATGTTCCCAATACGGGTTTGTCCCTGGCTTGC
AGCAGCCGAGTCGTTATCAGTGTTGTGGATATCAACGAAGCACCAACGATTTCTGGAAATATGCAGCTTGCAATTCCAGAAATGAGTACATTTGGAACCA
TTGTTGGCAATGTTGATGCCCATGATGAAGACAGCGGGGATGTGCTCACGTTCTCGCTACAAAATGCTGTTCTATCACCGTTTATGCTTGATACAGATAC
TGGTGTTCTCAAAGTTGCTAATGGATCATTGATTGACTTTGAAGATTCATCATCAATACCTATCACCGTTGCTGTAACAGATCGCGAAGGTATTCGGGCA
GTGGCGTCTCTAAACGTTGCAGTGATTAACGTAAACGATCCTCCAGTGCTTCAACCAACAAACTTTACGGCAAATGAGTACGTTTTAACCAGGAGCAGTG
GTGTATCTGAAGACCGTAATTTGGAGTTGCTTGGCTCTATGCATTGTTTCGACGAAGATATTGATGACGAGCTCATGTTTTCGCTGGTAAACGATTCTGT
TTACTTTTTTGTTGAACCCAAGAGTGGAATGATGTACGCGAAAACCAAATTACTTGATTTCGAGAGGGAGCGTGCCCATAATCTAGTTATTGAGTGTTCA
GATGGAAAAGCAAAGGTAGCTTCGACAGTGTGGGTGTTTGTGAGGAATATCAACGAAGCGCCAATTGTTACTGGCCAGGTATATCATGTCATGGAGAATA
CAGCAGCTGGTACTAGCTTAGGCTTCATCAATGTTTCTGACGCTGAGCACGACGAAGAACACTTCTTGACAATTTTAAATCCTGGGGTCGAGAGCGACTA
CATAGTGTCCAAATTTCAGTATGAATCTCCTGTTTTTTCGGATACGTTGGATGTAGAGTGGGTGGATATCCCAAGCAAGTTTCACGATGCTTTTATTATT
GCCACTCCCACGTTGTTGCCACTGTCAAATGTGATTTTAAACTTGGCGAGTCCAGGTGACTTGTTCATACTACACGTAGTCGAAGAGGATTCTGACGATG
ATTTGGACTGGATATCCCAAAACTCGTTCGTCAAGTTGGAGGGGCAAACCGTTTCTGCTCAAAGCAGTACAGGTACGACGAATTATGATATTTACATTCA
CGAAAACTTCAACGGAAATTTCGATGTCCCTGGCACAAATTCAATGAGCACGGTGCTGATATTTGGTGCTTACCCTTCCTCCCTTGAATTCTTTATTCAC
GGACCGCAAAGTCGGTGGTTTGACATCACAAATTCTGGAGAACTGCTACTGTCTACGTCAACACTTGACTACGAAGCCATTGCTGCTATTGAGCAACCGC
TTCGGGTTGTTGTTAATGTCGTAGACAGTAAAGGGTTAATGGGAGAGGCGACACTTTCTGTCTTTGTAGATGATGTAAACGAGGCACCAGTAATCACTAA
CTGCTGCTTCGAAGTCCATGAGAATCCAGCTATTGGTACAATGTGTGGCGAACTCTCAGCCTGGGACCAAGATGCATCCGATCAAGTAACTTTCGAATTG
GCCTTCCCGTCTGCAGGCATTTCGTTAACACCAAACGGTAGCTTGTCTGTTCGTGATACTTCCGTTTTCGACTTCGAAAGTAATTCTGTGGTGACAGCAC
GGGTACGGGCGACTGACAGAGGTGGGCTCTTTGATGAACGCGAGATTCAGATTACGATTCTAGATATGAACGAGCCTCCCGTTTTCCAGCAGTCTAGATA
CTCATTCAGTGTACGTGAGAACACAGCAGCAGGTGAAACATTTGGAACACCAATCCGTGCAATTGATCCAGATCGTGGACAAACTGAAAACTTACGCTAC
GAATTGGTGAACAAGAATGCCGGGGGGCTGCCATTCCGATTGGAGAGCTGCTCCGGTCAGCTCGCTGTTCAATGGGACAAGTTAGACTATGAAGGTACCC
GTCAATATTCGTTTGGTGTACGCGTAGTTGACTCGGGATACCCTGTAGCTATGGAGACACACGTCCAAGTGGCGATCGAAATTCTCAACGTGAATGAGGA
GCCGAAATTTGCCGAATATGGAGCTTTTTCCATCCAAGAAAACTCATCAAAAGGAACTTTTATTGGCCAAATTGTCGCTACAGACCCGGATACAGCATCG
AATATGTCCTTCAGTACCAATGCTAGTGGTTTTGTGTCCATTACCAGTACTATGCAGCTGTATTCTGTGGCCGTATTCGACTTCGAAACGATGCCTCTAC
TGTATGTAGAAATCTCAGTTGAAGACGATGGTGTGGACTGTGATCCAAGGCTGGATGCCTCGGATTGCGATCCCATTTCAACATCTATTATTGTTGTTGT
TTCGATACGAAATGTGAATGAGCCTCCGTCTCTTAAGGCTGGAACGTTTACTCTTCTAGAGAACCTCTCTCCAGGATCTCTTGTTGGGAAACCAATCCAG
GTCGTTGACGTAGATGGGACAGTGGGGGATACATATGGATTTTCAATTACAAGCGGCCTCTCTAGCGAGCCTGGCCCTGAATTTACGATTCGCAATGATG
GTCAGCTTCTAACGCTTGTCACTCTGGACTTTGAAACAAAAGCTGCGTACAATCTGAAAGTGGCATACTCAGATGGTGAATTTACTTTTGTGCAAAATAT
TACGGTCAGTGTACAGGATGAAAATGATCCGCCTTCTGTTGTTGGAGGTCTTACTGGATCCGTACAAGAAAATATGCCTTCTGGGACACCAGTGCTGACT
GTGCGATTTACTGATCCTGACCACAGTCCAAGAAACACTTTCGATCTTGTGGATAGTTATGCCCCATTCACAGTCGACAGGAACACGGGAAAACTACAAA
CAGCTCGCGCCCTGGACTACGAAAAAGATCCTACCAGTTTCAATTTGAATGTGAAAGTCTGTGATGCTGCACAAACGACGTTGTGTGGATATGGCTACGT
TACAGTTCGCATTATCGATGTTCCAGAGGCACCATCGCTGGGGCATGTTACGTGTGCAATAATAGAGAACTCAGCTACAGTTATTACTGAGCAAGCCACA
GCTGCGTGTACATTTATTGCAAACGATCCGGATCAAGATTCATGCTCTTTCTACGAGATTATCGATACCAACTCGCAATTTGAATTGATGCACGACTCAG
TCAAGAATGAGATTCTGAAACCTACCGTATGCACAAGTGGTCGAGTTGGGCTTCATTGGAAGGCATCGTCATTATCAGACTACGAGATCCGATCAGTATA
TTCGATCTCGATCCGTGTATCGGACGAAACGGTGAAAACGACTGGTCTTTTCATTGACAGTCAAGTTGAAGTCAATGTTATCAACGCCAATGACTGCCCC
ACTCTGGCTGCATTGTCTTTCACCGTTAGAGAGCGCTCAGTGTCTGGCACACAAATTGGATACCCATTACCAGGCAAGGACCAGGATATATCGGACAGTC
TGACGTACGCAATCGTCGAGACAAACGCCACCTCGGGTTTAATTGGGATTGATCGCCTCACAGGACAATTGACCGTGGCTAGGGACCCTTCCAATAATGA
GCTCGTGTATCCGGTACAGTATGCTGTGACCGTTTCTGTGACGGATAGCAGTGTCCAAAGCTGCTCAACCAATGCTCTCGTTGCGGTGATTACTACGAAG
TCCAACTTTGCACCGATATGGGTTGGTACACTACCGGTCTCCTTCGACATCAAAGAAAACTCTGCTGCAGGAACTCAGGCTGGCGTTCTACTCTCGAGTT
TTGTTACCGATCCTGACAATGACGTGATCTCGTTTACACTGCAATCGAAGACCGACACGTTTTGTGCGGATACTTTCAGTCTGGGGCTGACAAATGGAGC
CATTAAACTTCGTGTAGGGCGAACACTGGACTATGAAGAGCGACGAACTTACAGCTGTACTGTAGCAGCTTGTGATCCAGCCCAAATGTGCAGCACTCAA
GATGTTATAGTTCAAGTCAAGAACGTCAATGAGGCGCCGAAATTCGGTGAGCAGCAGTATACGTTCGAGGTAAGAGAAAACCAAGAAACAAACTTTGCGC
TTCCGCGCTGTATAAGCGCTACAGATCCGGACGATGGCGACGGGTATGCTCTGGCTTACGCGTTATCGTGCACGGATTCTGCCGATTGCTCTCTATTCTC
TTTAAATATTGAGAAGGACTGCAGCCAGGCACTTTGTGCTCGGATTGTTGTCAAACCAAGTCTAAACTATGAAACTCGACGTAGTTACAGCTTCAATCTT
CGATCTCAAGACCCTGGTAATTTGGCAGCTACTGCGGCTATTGTCATCAACGTGGGAGACGTGAACGAGGTACATTCTTTTGTGAACTTCCAGACGTCGA
AGTCAGTGCAGGAGAACACGCCAGTAGGCTCTGTGATTCTACGGGTCAGCACAAGTGACCCAGATATTTACTCGGCCCCCTTCAAATCGATTACGTACGC
GTTGAGGGCAGTCACCCCATCTGGATTGAATGTGTTTCGAATTGATGCTATCAACGGTGACCTCATAGTTAATGATGTCATCGACTTCGAGGCTGTACAG
GGCTATACACTGACAATTGAAGCTCGCGATTCAAGTCAAACCAATGCGCTCGTTATTTCCAGGGATCTCTCCATTACAGTGGTAAACATCCAGGACACGA
CGTTGGATGCATTCGAACTTGTGGTTGACAGGTCTCGTAAATTAGACACAATTGGTGGGGAGAAGTTCATCCTGACGGGTCAAAATATCGGATTCAAGCA
GCGTCTTGACAATTCCGTGGAGATTCGGCAGCTTCTTGTGCAATACGGGACTTATGGAGCTGACGTGTTTTACACTGCAACAGGCTGCTCGCTAGTGAAC
GGAAACACTGGGGTTGAATGTACAACAGCTCCAGGCATCGGTGCCAATCTTTTTTGGAATATTTCGCTGATCATGCGGGTCCCTAGCATTGGCGACACCA
CCTTCCAAGCATCTTCGTCAGACGCATTGGCATCGTATGGACCACCCGTTATTAAATCTGTGGTCTGCAATGACGTTTTCCCTACCAGTGGTAGCGAGGA
GGAAAATATCGTCTTATATGGTGAGAATCTGGGATCTGTTGCGTTAATGAGCTCAAACGCGCAGCCTACTGTTCTGTATGGCGTTGACTTTAAAGCACAG
AACTGTCGACTATTCGTGTCTACCACCAACAATGTACCCACCCGCCAATACATTACGTGCCGCAGTGTTCTCGGGACTGGTCATAAGCTGCCTTTTACTG
TTGTGGTTAACGGTCAGGCGAGTGAAACTCTCACTACTAGCTGCAAATACGCTTCGCCTATCATTGCCGCAGTGAGTGCGACTGACGGGATTCAAACACG
TGGAGGTGACACAATTACTGTGAAAGGAAGTGGATTTGGATGCCAAGGCTGTTCCAATCTCACAGTACGGTACAAAAATGACCTTCACACATATGATCTG
GACGACTGTAAAGTTGTTGTCGACCACGTTCAGTTGTCTTGCTTATCTAGACCTGGTGCTGGGAAATTCTTCCAGTGGCAGGTTTCCATCGACAACCAGG
AGAGTGCATTGACTAGCGAGATTTATACCACTTACGACTTGCCTCGAGTATGGGAAGTGATGGGGTTCAAGGACGTTCCAACTGCCGGAGGAACCGTTTT
CCAGTTGCGTGGTCGAGACTTTGGTCCGGATGCTGCCGTGTATGTGGACCCAGTCGTTGAATACTCTTTCGACAATGTTACTGTTTTCCGGGCGGTTAAT
TGCAAGCGGAAATACACCGACCCGGCAACCCACAACTTAATTGAGTGTGTGTCGAGTCCTGGTAGTGGCTCATTTCACTCTTGGCGGGTGACGATCGAAG
GTCAAACGTCTCTTTGGTCTACCCATAACACATCGTACGCTGGGCCAATCGTGAACAAAGTGTTTTGCCCAAATGGGGATGCTGAAATCAAGACGAGTGG
CGACCAGGAGGTGGTTATCACTGGCAAGAACTTTGGCACCAGGAACGAGTCTATCATTACCAGTGTCACGTACGGCGTCAACGGGGATGAATTCACGGCA
AGAAACTGTGCGATTGTGGTCGACCACGAGCGCATTTTGTGTACGACTTCACCTGGAGTGGGTAATCGCCTCGAGTGGATCGTCACAATTGATGGATTGA
GTAGTGCGGCGCCCACTATCAGTTATGCGAAGCCGTACATTTCGTCAATTGAAGGAGATGGAGCCGTCAATGCCCATATTCGCGGTGGGCAGAACGTAAC
TATCGTTGGGGGAAATTTTGGCCCGAGTAGTGTGGCAATTGACCGCATTTCATATGGAATATCTGGACGAGACTACCAAGTGACAGAAGTACTTCAACAC
AATGACTCGGCTATTATTTGTACCACCGTGCCAGGTGTTGGAGCGAATCTCTCCTGGATAGTGTCTGTGGGTGACCAGGAGTCTAGGTTATCAGCTTCCA
CGACCTCGTATGCACCTCCAGTAGTAACCTCCTTTTACCCAAATGTGGCTCTTACTGATGGTACAACACAGATAACCATTATTGGAGAAAACCTTGGGGC
GAATGTCACTTTTGCGGCATCCCGAACGCTTTTCTCTCCGCCCCAAAGCAGTGCATCAGCGTATCGAATCCCTACTATTGCTTTTGGAGATTTTGGCGAC
ACCAACACCAGTGAATACGTAGTGGTTCGAATTCCAGTGGGCTATGGAAGTGGAGCCTTGTTGCAGATTTTAGTTGGAGTGTCAAGTGTTCAAAAAAGTG
CTCCGCTGTCGCTGAACTACAGTCCTCCTTTGATTGACTCGGTGTATACAGAAGAAGGTCCGTCTGAATGTCTACCTTCCTGTGTACAACTTACCATTAC
AGGATCGAATTTTTACACAACCGGTCGAGTGCTTATTTCGAAATATCCAATCACTGTGGATAATCTAGAAGCTGCAAGTTACGAATCAACAGTGGTGTAC
TCGTATTGGTATCACGATACTATCGTTGTACCGAAGCACATTGGCCAACTAGGCTATGTTACAATTGTGATCGGCAAAGAGAAAGTTATCAGCAATTCCG
CTCCATTTAGATGGGACGATCCCTCAATTCTTGACTGGTACACACTCAGCTCTACGTGCAGTGTACTGGATTGCTCAACCAGTTATCGTCTAGATGGAGA
TACAAAGCTCTTCCAAACGGAGACAACATCAACGTCTGGAGTTTTTAACTACCTATCAGCGACTAATGGCGGGGCCACTCTAAGTCTATACGGGAAATAC
GTTGGTCGAAACCCTCGCATTTCTATCGGAGGTAGCATATGCAGCAATGTTGTGGTTACTACCCCTGTCATACCGTCAAGTGTGCTTTTAACTGGACTAG
TTACTGGAGTGAGCAGCATTCGACTGATTTCATGCACTGTGCCTAGCGGCCAAGGGAACATGCTCACCCTCGTTGTTACGCGAGGAACAACTCTAAGTAG
CTCGAGGTACTTCAGCTATATTCCTCCAACTGTGGATTGGGAAGCGAGTCTTGCGACTTCTTCTGCTACCCAAGGCAAAGAAGTGACGCTTACTGGATCC
AATTTTGGTACCAGTCCCATCGTATCAATGATCTTTAGTGTCAATTCGCCTGTTTCGCTAACCATTTCATCCTTTGGTCACTCTCGCGCAACGGTGACGA
TTCCTCCTGGTGAAGGCGAAAACTATACTTTGAAACTTGTTGCTGGAAATCAAGAACAATCGACGACGTTCAGCTACAATCCTCCAGTAATCAGCAGTAT
CGAAGTTATTGATGCCACCACAGCAGGCGGGGCGTTGATGACCATTCGAGGAGAAAATTTTGGATCGACGCAGCTTTCCGATGCTCATTCCGTTTCTATA
GGTGACGCGTATTCCTGCACAATTGTTACTGTCGACCACAAAGTAATTACTTGCAGGACAAGCGAAGGTCAAGGAGGTGGTCATGTTGTCATTGTGATGG
TCAGTGGACAAGTGAACGTCGACCGGTCCAAGAAACTCAACTATGATCCTCCAGTCATTTACAATATCAGTAGAAGCGACGGACCTACTTCTGGTTACTC
TTGCAGCTGTACAGACCCGGATAAACCCTGCGCGACACTTGCGGCTCCCGTTGAATGCCGTTATCTGGAGGCAAGTTCCTCGAGCCCCTCGATAGACAGT
TTCTGCGTCCAGACAGTGTTGAACGGAACTCTGGAAAAAGTGACTGTCACTGCCATGAAAGATGTGTATTCCAGTAACAAGCCTGTGTATACGAGTGGTC
AAGAATCTGAACTAGAGCTGCTTTATACTGGTGGATACTGGCAATTACTTCAGAATGATAAGCCCCTCTATCGAGCTAGTGCGGCCACCGGGAGTCCGCC
ACCATCAGGGTATCTCGATTTGACTGTAGATCCTCCTGTTAGTCTCTCCTCTATGAAAATTAGTCCAGGGACTTGCTCTAAAGCAGCTTCACGTGCGTGT
CCTGCAGACACGGAGCTGTGTGAACGAGTAGCTATCACATTGGTAGGCAAGAACTTTGGAGTGCAGTCGCGTGACTGGAAGCTTGAACTGGGTAGCATTG
GAGGGAATGAAACGACAAATGTCACTCACGAGGACATTATCTACTTCAGCCACTCCAATATCAAATTTTATCTTCCGCCAGGGCAAGGCATTTCCCGCTT
TTTTAACCTCACAGTGTCTGAGCTGAAGCTGGTAAACGACTCAATCCCGTTCGGCTATCAGATTCCAGAATTGATAGGATACGAGACCAACACGAGTAAT
TTGTCAACATGTGGCGGCTACACGATAACTCTCTACGGGAAAAACTTTGGATCAACTGGAGCTAAAGTTCTCATTGGTGGTCGCGACGCCCGCCTTGACG
GTCAGAGCTCCCATTCGAAGGCATGTGGCCCTGATTCATGTGAATATACGACGAGTGGTCCCTGTATCGACGTTGAGACGTTGGTCTGCTATCCGTCTCT
GTACGTTATAAGCCCTACATTTAGTTTCTTGGATTTGTGTGACGACGCAAAGGGGGTGAGAATTTTGTGCGAAGTTTCTGACGCTGCATCGGATATGGTT
GAAGACTTCGAGAGTCATTCAGACTTTGTGATCGTAACCACAGTACCAGTAGGATACGGGGCCGCTTTAGACGTATTCGTCATTGTGGACAATATATCGA
GCAACGCCTTGAACTATTCGTACAATCAACCGGTAGTGACAGCACAAATGCCAAACCAACCGGACGCAAACGGAGCGAACCCAATCACCATCAAGGGGGC
TGACTTTGGTTGCTTTCCGAACGAAGCTATAGCCATTTCGTTCGTCTCCACGGACACGGTGCAGTCGATTTCTCGAAAATTGAGCTCGGATATCTTGGAA
TTGTCAAATATTTCTCAAGATGAATTACAAAGGCGGTTAGTCGATACTACGACTTCATCCAGTTCAACGAACTCTAGCGAGAACTCTACGGGTACTATTG
TCTGGACAAGCGCTTCGGAGTTGGTATGGTATCCGCCTAAAACCAAGGCAGGAACTACGAGTATTATTCTATCAGTGGGAGGCAACGTCATGTCTCCTAC
AAGTCAAACGCAGCTGAAATTCCAATGTAGCCCCGGCTACTATCGAACGTCAACCGAATTCTGCGATGACTGCCCTCCCGGTGCTACTTGTGCCGGTGGA
GATGAATTACCCTTGGCCAAACCTGGGTATTGGCGTGAAGGTGTCGTTATCTTCGCCTGCGACCCCATGTACGCTTGTTTAGGCGCAAACAAGTGTGCCC
AAGGCTATAAGGACATTCGATGCGGCGAGTGTGAAATCAACTACCACGAGCTCAATTCAGAGTGCAAGCTATGTCCTGCGAACAAATGGGGGTCAATTGC
TATCGTGGTTGTTTGCATCGGAGTTGCATCAATTGTGAGTTATTTCCTCACTCGAAAAGGAGTGAGTCTCGGGTTGTTATCTATCGGAATTGACTACTTC
CAGACTCTATCTATCTTCGGCAACGCTCGGATCTCGTGGCCAACGTCGTTGATCAATTTGTTCTCAACTTTGTCAGCGTTCAACCTCAATTTGGAGTTGA
TAGCACCGGAATGCTTCTCCTTCCAAGTTTCCTACGTGAAAAAGTGGTTTGTCATTGAGATTTTCCCTTTAGCAATGGCAGCCATCTCGTTGGGGATTTT
CGTAGCACTGTACGCTTACAAGAGATTTATCAAGAGGCGACGCACGCGACTGACTTCACACCTGCCTCAGTTGTTCGGCTCCACCCTGGTGATGATGTAC
TATTTGTTCCTGTACCTCACTCGAACGACTTTGGATGTCTTCAACTGCGTTGGAGCGATACCGTCCGATGGGAAGCTCTACATGGTAGCTATCTACACGC
AGTGCTTCAAACCGGGAGGCGTCCACATGCAGCTCTTCCCGTTCGCGGTACTGGCCTTTGTCGTCTACTCACTGGGTTATCCGCTGTTTGTGCTGCTTAC
CCTTTCTCGGAATCGAGCGCTAGTTATGGAGGACCAGCTCTTAAGAGCGATGCAGCGAGGGACAAGTAGGCGAACAAACCCGAACTGTTGGGTATTTCGC
AAGAAATTCTCGAAGCTCTACTACCAGTTTAAACCTGACTATTGGTACTGGATGATTCTCATTGTCCTTCGGAAGTTCCTACTAGCAGGTATCGGGCTGC
TCTTCCGGCAAGATCCGATTTTCCAACTAGCGACGGCCACGTTCGTTCTATTCGTGAATTACGCGCTGCAAGTCCGCTGTCGTCCGTACATGAGCGCCTA
TGAGACGCAGCACGTTCTAGCCGACTACGCCAAGCGAGTACTGCGAGAAACTCGTCGCGCCAAGTTGAAAGGTGAAGCCTACATCCAGCCAGCGCATCTC
CGTCTCGAAATGCACGCCTCCACTGTGACCGCGTGGAAAGATGGTCACGGTGATCATGGAGGAACTGGAGTGACTAGAAGTTCTGCGCTTCCGATGTCAG
GTCTTCGTGGGGCAAATGAAGCCATCCTTGCTTCCCAGGAGCCCCAGAACCTTGTCGGATATCTGTGGGATCATAATACCGTAGAGGCGAGTCTGCTTTT
CAGTGCCTCATTGGTATTACTGGCCGGAGTCATGTTTGAAAGCGGTCGCCTGGGGAGTACCGAGGCCGGATTCACCAGCGCTTCGGCTCAAATGCTGGCG
GTTGCGACTACACTCCTCGTAATTGTGAGCTTCGTGTACTTTGTCCTCGTTCTCGTCACGGAGCTGGTCGTTGCTCTTCGTCCCGACTACTACAA