Description :
From Genome Similarity Track
Location :
Scaffold_1508:3444- 4643
Transcript NameFunction/comments
Phyag_g10827hypothetical protein PHYSODRAFT_486841
Phyag_g10828hypothetical protein PHYSODRAFT_506357

Sequence
1199 bases(100 bases per row)
TGGGATGTGTTCTCTATAGTAGCATTGAACCGTGTGTATGGTTATCTTGCAGAGCCAAGCTGAGCATGCGATCCAAGCTGGACGTATCGTTCGTCGCCCG
GTGGTCGAGTTCGAGCACCCGGTTGTGCGAACGCACCCTGTGACGAAGCGCAAGGCGCTCTTCGTGAATGCTGGGTTCACCAAGCGCATTAAGAACCTGT
CATCTGCTGAGTCTGGTACGCGCACTGGGCCTGTGTGCATCTCCGAAACTCTTGTTGCGGCGACTTACTTGTGTACTTTGTATCTTTTAGACGCAGTGCT
GCGATTCCTCTTCAAGCACATCGCTGAGGGACACGAGTTCCAGGTCCGCTACCACTGGACCAAGGACGCGGTGGCGATCTGGGACAACCGCTCGACAGCC
CATTACGCCACGTTCGACTACTTGCCAGGCAACCGCCACGCGGTCCGTGTGACGCCGCACGGTGAAGTCCCCTACTTCGACCCTGACGTCACTGCCCCAT
AAGCAGGATTTGGTCGGTCAGCTTTCCATTGTAGTAGAAGGTTGCTGTTTGTGTGGCAGTACGTTTTGGCAGGTAGGTGTCGAGAAAAGTAATACTTCGA
TATAATTCCCATGTCAACAAGAACCAACGCTGGCCAACAATATCCtaggtgctgctgggcagcaacagcaatggGTAAAAACGGAGAAAGATGATATCGA
TTTTACGGGCATTCTAGAGTTCGCTAGAGTACCGCTCCAATCGCGGTAATAATGCAGTCTATTCCCTGCGGAGAGTAGTTTTGCCAGTTCCAGTCGAGCG
GGTCTCAGGCTCAGCCgtgccaacaacagcagatCCGTCGTTGTTTCCCGAAGACTTCCACACGGTGTCGGCGCTGTAGTTGCCCATAAGAATGGAGCAG
TTGGTCATCTTGACGGGCGTGGCGACAAGCTCGGCTTCAAAGGCAGTATTGTCCATCTTGGGGGCGTTCACCTCGAACTCCTGGCCTTCCAGGTAGCAGC
ACACAAAGTCGTGGAAGCGGTTGTAGGCAGCAATACGCTCTTCCGAAGACATCTTCGCCGTGCGCTTGAACGTTCCGAAGATAAGCTGGCGGATCTGCTG
GGGAGTGCCCAAACACAAGTCACGCGACGAGAAGACCGGACGGAACTCCTCCGGAATTTGGCAACCAGGCAAAGCCTGAATCGGGTCCGGTGTAACCAC