Description :
From Genome Similarity Track
Location :
Scaffold_24:344394- 350143
Transcript NameFunction/comments
Physo_133108reverse transcriptase
Physo_133109hypothetical protein

Sequence
5749 bases(100 bases per row)
CTTACTCTGACGCAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCGACACCTGAGTCTGTATAGACTGACCCTCTGTGGAGAATG
GAGCAGTTCACTCACTTGCCCCCGAACCAGCAGGATGCGCTTAAAACGCTTATGTCCTTGCTGGGCCCGGAGGGCGTGACGCAACTTGCGCAGCAAGGCC
CCGACGCGGTGAACGCGCGTCTCGAGGCGTTTTCAAGCTACGAGAATGCTCTGCTAGAGCACCTCTAGCAGAGGATGGCGACTGCCGCGGCGCCCCAAGC
GCCCCTTTCGTCGTCCGACGCGGGAACAAGACCCAAGCCGCTCATGTTGAGCGTGAAGACCTTCGAAGGCAAGGAGGGTGAAAGCTTGATGCTTTGGACC
CGTGAGGTTGAGATGGCTATGAGCTCAGCTTTACTCCGGACGGAGGCGCAGCGCGTGGCACTAGCTATCTCGAAGCTCGGTGGGGGAGCGAGAGAGTGGG
CACGAACGTCTGTGATGTCGGTCGAGGTGGCCTTCCCGACGTGACCAGCTGAAACAGCAATTGTCCCGAGTGTTTGCTCCGCCTAACGAGGCGTATCGCG
TGCGCTCACGCTTTCTGGCGACCAGGCAGAGCAAGAAGGAGTTGATGAACTATGTCCAAGAGTTGAGAACTCTCATTGCTGGCATGTCTGCGGACCCCCT
GCCGGAAGCAGTCACCGTTACGGTGTTCATGGAGGGCCTCCGCACTGGCGTTGCCAGGACGGAGGTGTTCCGAACCCACCCGAGCTCTTTTGAAGAGGCT
GTGAGCGTCGCATTGAATGCGGAACACAACTTTAAGTCGTCGAGACTTGGGTGGAATGCGTCTTACGCTAGCGCGTCGAGTGGTCCGGTACCCATGAACC
TCAGCTATGCTGAAGACGAAGAAGCCGAGCTTCGTGCTGCTGAGCAGCGTCGCGGCATCCGCCGATGCTTCATCTGTGGTGACACCCGTCACCTTCGTGC
TGGGTGTCCGCTGCGCCATCAGCGCCAGGCTTCGTCAAGCCGCTCTTCGAGTTCGAGCCAGGGCTCTGGTTCGTCTCGGCGAAACGAGAAGTCCCAGTAG
GCGCGGGGCGACCTACTGGGGAAGAACTAAGTTCTATTGAGCCTCGGCGAGGTGGAGGTCGACAGGACTTAGCCCCGATGAGAGCCGTACTCTCTAACAC
GGAACGTATATGCAAGCCGGGCTTGCTAGTTGTCCAAGCTTGGGTGAAGGGCTTCGCGAAGCCATGGACGATTTTGATCGATTCGGGAGCGTCGGGAAAC
TACGCCCGGCGTTCTACGATGGACGGAAGTCAGCTTTATGCTGAGGCGCTGGTAGCGCGCAGGAGTGACATCGTCACTGTTTGTCTCGTGACGGGCACTC
GTGTCACGGTGCCTAAGGTCCCTGTGGACCTGGGCGTGAAGTTTTTGGATTTCGATAGCGTGGAACGCTGTCTGGTCTTAGACCTCGATTCGAGATATGA
TCTCATCCTTGGTATGGCGTGGCTGGAACGCCACGACCCTTGGATCGATCGGAGGTTGAAGACCCTTGGTGCTACGCACTTCTCTCCTGGCGGAGCATTG
GCGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTCTAGCGCGAGCACTGGACCGGGTTGGTCAATGTGCTGGCCATCGGAGTTTCCGAGTTGG
TGGACACTGAGTGTGTCGAGAACGAGCGTTCCGAGCGTGGCTCGCGGACGGCAGGTGGGGCGGCACTAATTCCGCTGAACGGGCGTGCGTCTGAGGGCGA
CGCCCTGCTGCGTGCCAGCGACGGCGCGGTCGGCACGATGCCGAAGAACAAGGGGCTTTGCCCGGATGAAGATCGTGGAGTGGCACGCAATCCACTGAGT
GGAGGCTGCGGATCGTGCAGCTCTTCGCTGAGTGTCGGTAAAGACACTGGAGCTCCCCTGGAGATGAACGAGGTGGTGACACCTGGCGTCAAGACGCACC
CGAAATCACGGAGCTCTTCAGGGCGGACGGTGTCCATGAAGAGGAGGCAGCACCACAAAGCGCTGGCCGCGAGACGCAAGGCGTCTGTGATCTTACGAGT
CGAGAAGGGCGTGTCGAGCGGTGAGGCTCCACGCGAGCACGAACAGCTCTATAAACTCGTGAATGGAGTGACGGGCGACGTCGACGGAGGTATCAACCTC
GACGACTTGCCCTCACTGTCTGCTCTCCTGGAGCTGGACGAGATGTCCTTGGCCGAGTTCGGCAAAGCCTTGAAGGCTGGTGACTTGGCTGAGGTAGTGG
TCATACGACCCGAAAAAGAGTTGAACTCGTCTTCGCTTCTGGATGAAGCTGTCCTAGAAGACACAAAGAAGGCGCTGAATGCGCGGAGCGGATCGGCGAT
CCTGAGGAACCCGTCGGATCCCTTGTATCAAGTGGTAAAGGATTACCAGGACGTGGTCTCGAAGGAGCCGCCCTGGGGGCTACCTCACGATCGAGGTGTT
CGACACGAAATCGATCTCGTTCCGGGAACGAAGTACTGCGTGACGAGGCAGTAGCCCTTGCCGAAGTAGCAGTGTTACGTCATTGACGCGTTCTTCCGTG
CGAAGCACGAGGCGGGCATGGTGCGTGAGAGTAAGTTTCCACACTCTACGCCAACGTTCTGTGTCAGAAAGCCGAATGGCAAGTGGCATAGCGTGCATGC
TTTCAACAAGCTGAATGCCGCTACCATTCCGGCGCAGACGCCGATTCCTCGGAAGGATGTTCTTCAGAACAACATGACAGGATGTACGATGTACAGTGCG
CTCGACTTGGTCGATGGATATTACCAATTGCTCATGAGGACGAGCGGCATGCTCTAGGAGTGGTTGGTGATGCCCCGAGGGCTTTCGAACGCGCCAGCGA
CATTTAATCGTCTTGTGAGGCAGCTCTTCAGGCCCCATCGGGCGTACGCGCATACGTACTTCGATGACATCTTTGTCCACAGTCGTGCGGAGCACGGAAA
GACTGATATGGAGAACCATGTGGAGCACCTGCTGGCTGTGCTCGAATGCATGCGTCAAAACAAGTTGTACGCCAACATTGACAAATGTATCTTTGGAGCG
GAAGAGATCCCCTTCTTAGGGCCTGAGGGCCGACCCGGTCAAGGTCAAGGCCATTGTTGACTGGCCGGTTCCCAAGAACCAGAAGGATCTTCGCAAGTGG
CTTGGCTTGGCCAATTACTTGCACAAGTACAGCGAGAACTACGCTGAGATGGCTCGGCCACTCTCCAATCTCCTGAAGAAGGATGCGGACTGGTGTTGGG
ACACCGAACATCAAGATGCGTTCGCGGCCATTAAGGACAGTCTCTTTCATGCGCCTATTCTGGCTCTGCCAGACCCCGCTCGTCCGTTTAGTGTCGTCTG
TGACGCCTCGGACTTTGTCTTCGGCTGTGCACTGCTGCAAGCAGACGCCGAGGGGCGCGAGCGATCCTGTCCATGACAAAGAGCTACATGCGATGAAGTA
TGCGCTCGTCAAGTTCAGGGTTCACCTGTTGGGCTCTCAGCCGTTCGTGATTTACACGGGTCATGCGTCGTTACGCACTGCGACTCAGTCGCCTCACCTC
TCGCAAAGGATGGCCCGTTGGTTGTCCTTCTTCGCGGAGTAGGACTTCGAGGTGAAGTAGAAGTCTGGCAGGCAGAATGTCCTTGCGGACGCGCTGTCGC
GCAGGCCCGATTATGAGCTGGCTCATGTAACGACCGTGACTTCGTCATTACCAGATCTGATCCGAACGGCTTATGCCAAGGACGACACCTGTGTCACGCT
GCTGAAGGCTCTGGGGAGCAAGGAGTTTCAAGACTCGGACATGGAATTGTCAGCGCGGCTGCGCGCGCGGCTACACCGCTATTCCCTCGATGCAGGCCTG
TTGTTCTACAACACTGGCCCCGAGGATACGCTCCGCGTGGTCATCCCTCATGATGAGGACGTGAAGTACCGCATCCTCTATAAGGCACATGACACGCCGC
TGACAGGCCATCTTGACCATGAGAAGGCCTACAGCTCGGTGAGCACCCACTACTGGTGGCCGAAGCTTTACAAGTGGGCGAGCACTTATGTGCGCACCTG
CGAGACGTGCCAGCGCGTGAAGTCGTCACCTCTTGCTGCAGCGCCGTTGGCGAGTTTGCCTGTCCCTTCGGGCTGTCGGCAATCCATGAGTATGGACTTA
GTGTTTGGCCTGCCGGCGGACGCGGCGGGCAACACTGGAGTCGTGGTCTTCGTGGACCGACTGAGCAAGATGGCTCACATTGCGGCTGTGCCGGATACCA
TCGATGGCAAAGGTACAGCAACGCTGTTCTTGGACCGAGTGTTTCGACAACACGGCCTCTCTGAGTCGATTGTCTCGGACCGAGACCCCCGCTTCACGGG
CAACTGCTGGAGCGCGGTCTTTGCGGTGCTTGGCACCAAGCTTGACATGCCCACGGCGGACCATCCGCAGACCGATGGTCAGACAGAGCGCGTGAATCGC
GTCGTCGAGGACGTGCTCCGCATCATTTGCGCCGAGACGCCGAAGCGCTGGAGCGCCATGCTGCCACTCGTTGAGTTTGCGTTGAACAACGCCGTGCACG
CCTCGACAGGCTACACGCCGTTCTACGTGAACAGCTTGTCTCATCCCCGCGTCCCGCTGACGCCGCCACGTGATGGCCTCGGGCTTGGTGGGGGGGAGAA
GCCGATTTAGCTGATCGGCTAGCCGATGTCAGCCCGGCTACTGTTCGTAAACAGGTTGACGCTTTCTTGTCGACGTGTCTGAGTGTCTTACGACATGTGC
GTGACGCAATGGCTGAGAGCCAAGACAAGCAAAAGGAACATGCAGATGCCAGGGGCAGAGGCAATGTTGGAAGTTATGAGGTCGGGGACCTGGTGTTGCT
TAATGCTAAGAACCTACCTACACATGCAGTGTCAGCCGTCTTCAAGACGAAGTTGCGCACGCGCTTCATCGGACCTTTAAAGGTTGTGGCCAAGAAGGGC
CTTGCGTACTCGCTCAATCTTCCGAAGAAGATGCGGACGCACCCCGTCTTCTACGTGGGCTTGCTCAAGTCGTACCAGGACCCGATGCAGGTGCAGATGG
AGGCACCGAGGGTGACGAAGTCACAGGCGCGGAGGCCGTGGTCGTCGAGGACACAGTACCAGGTGTCGAGGACGCGGCCATTCACGTGGGCACCGCAGGC
ACAGGCGGAAGAATCGGCGCCGGAGGTGCCGCGGGCACAGCGAGAGCCGCAGGCGCAGGAGGCGCAGCATTCGGAGCCTGCATGCGGGCCAGGAGGTCGA
GCTGACCCTGAAGCACAGCCTGCTGACGCTGTAGCTCCCGGCCACGCTGCTCATCGCGATCATGATAGTATCGCACCCAGTCCTCCAGGGCCCCAAGGCG
GTCACAGACCTCTCGAGGCACCTCGATCCATCGTGTCCGCTCGGCGAGCTCGTCGAGTTCGGTGACAGTCCGGCCCAAACGCGCATCAACGTCATGGATA
TGATCCCGAAGGCGACCCGCCTGCTGCCGCGCCTCCAAGAGCTCACCTTGAGTCGCAAAGGACCCCACAGCGGCCTCCACCGGCTCTGCTCCATGAGAAT
GGGAATCTATATTACCATGTGGAGCGCCTCCTGGCAAAGCGGCGGTGCCGGGGTCAAAACCAGTATCTGGTGAAATGGTGAGGGTACCCTCACTCCGAGA
ACTCATGGGAGTTTGAGGTGACCCTCCGCCAAGACTGCCCAGACGTCGT