Description :
From Genome Similarity Track
Location :
scaffold_47:34431- 35467
Transcript NameFunction/comments
g13200.t1 hypothetical protein PHYSODRAFT_293408

Sequence
1036 bases(100 bases per row)
AGCCTCCACCACGGACGCGCACGGGATGTTTGACCACCAGGAGCTCCTGGGAAAGAGCTCGGACGGCGAGGAGAAGAAAATGGGGAGGCCCAGCCACCCG
GCCTGGCAGTTCTTCGTTCGAGGAGAGAAGCGCAACCGCTACCACCACAACGCATACTGCAGGTTCTGCAGCGAAAATGGAGTGGACCCCGTTGCTGTGA
GAGGCGTGTCGGGGAACATGATCCGACACCTGCAAAAGTGCATTTACTGCCCTGCGGAGGTGGTGACGCAGCTGAAGTTGCTCTGCGCGCAGAAGGATGC
TGCGAGCTTTAACAAGAGACATCAGTCGAATCGCAGCGTCGACGTGTATTTGCAGGACACGTCGCCCGCTCCGAAGAAGAGGACGCGGCGAAGTGTAGGG
GCAGGAGACGGAGCTGCTGTACCGTTGCGAAATGTAGCCTTGCGCGGATCCGTAGCGTTGGATGGTAAGGCGAGTGCTGCTACACAGGATACAACTGGAG
TGGAAGACTTTATGCCACTCCAATTGCCTTTGTTGTCCACGGACATGAATGGAGCGCTCACGACGAGTATATCTTCCAAACCGCTGAGCTATGAAGAAGC
TGCTTCCACGCCGAAGAAGCCAAGCGCGTCTGCGAAACCTCGATTCCGAGATGTCGGGAAGAAGCACGGGAATAATCGAGCTGTTCAGCAGCAGTCGAAT
GAACTTCCGATGACTCATGTGGCAAATAACGTGGCCAGCTCAGGCACTTTGAATAAGCTGATTGTATCATCAATTGTGTCAGCGGGGCTGCCTTGGGATT
GGGTGTGGACGGAGCAGTCTGCTCGAATGTTTGGTGATCTCCATCAGAAGGTCGACCCGCCAACTGCTGAGTTGTTGGCATCGATGGGAACCACTTCGTA
TGAAAAGCAGATTCTGAAAATGAAAGACGAGTCAGTTGGAGTTACGCTAGCAGTGAGCTGGTGGGTGGCCAAGTATCCACGATCGAACTTTGTACTGCTT
TCTCTCGTAAATGCTCTTGGCGAAGCAACTGTCTGG