Description :
From Genome Similarity Track
Location :
Scaffold_47:34430- 35747
Sequence
1317 bases(100 bases per row)
CTTGTACAGGTATTTAACCGCAGTAATATCCGTGCACACTTCCACATTGATGTGGCAGTTGTACTTCTGGGATAAGTACGGGTTGTATGGTACAACCCAC
TGGTTGATCGTAGCATTGTCGTATTCTCTGCCTTTGAACTTTAGAACACCTTCTTGCCGTCGACGTCGTCTGTACACTGGATATCCGTTGGCATTGGCTT
GTGTAACTTCTGCTAAGGGCTTCGGATATCCTTTGGTGCACTTGCCGTCCTTCATACACGCGCAGGAAGGGTTTGCAGGCCCACATGGACCATGGAGCAT
GCATGCCATGACCGTCTCATACAGCTGAGGGTTTGTATCCTTATCTGGGATCTCAGCGCATACCATCTTGTCTACGATCTCGCGCGTTCGAGGTTTGTCT
TCGTCAGCCAGAATAATCAATACGTGAGCGTGGAGGAGCCCTCGTTTTTGAAACTCGACAACGTAAATCCGCGCGCGCACTCGCCCCAGGACGCCTTGGT
TTAAATCGTCAAGCGTCGCTTGCAGTTTCTGCTGCCACACGCGAGCCACGATGTCTGGTCGATCTTGAGCTGTCTGGATATCGGAAGGTATCGCTTCAAG
TAACTCGTCCCACTTAGGGTTGCACGTTTCCGTCAAGAAGACGTCGGGCCGTCCATACTCCCGAACAATTGCCATCGAATCTTGATACGACTTGTACATG
GACCGCGGGCTACCCAGGTGCGAAGCCGGTAGTATGATACGCTTGCCAACCTGATTAAGAAAGTGGGTAGGTCGTCCTCTGTTGCCTCCGTCCTGGTCCG
GGTGCACCAATCTGTTCTGGACCCGGTCGTATTCCGACAGCAGCACTTCTCCTTCCGCCAGAGCCAAAGTATCTTAGTTGAGCAAAGCGTCTTGAACACC
CCTGTATTGATCGGCGCGAAGTGTTTTCTGATTGTCGGCCACCCAGCGAAGCTGTTCTTGCTCACATTTTGCACGCTGATCTACACACCACTGTTGAAAT
AGACGCCCGCCTTGGTGGAGAGCGGACTGGTCACCCACTTTCTGATGATGGCGGAACGCGACGTGTTCACGAAGCGACATTGCCTTCTTGTTTCGATACT
CAGCACCATTCGCGAACTCGTCTGTGTAGGTCCAGCCCTTCTCTCCATATGGAAGGAGAAGCGGGTATTGGAGTGGATCGTAATCGGCGTGAGTCTCATA
CAAACGTAGCAGCCTTTGATCGCGTGTAAAGAGCAGTAGATCCCGAGGCTGAGCCAGGTTGCCATCCTCAATGAGAGTCGCAGCCACTTCAGACACAGTG
GGGCGGTTATGCGTCCT