Description :
From Genome Similarity Track
Location :
scaffold_176:34419- 35993
Transcript NameFunction/comments
g5152.t1 hypothetical protein PHYSODRAFT_472581

Sequence
1574 bases(100 bases per row)
ATTCGTGGGGTGGGCGGGGTATTGGGATGCGTAGGAAGTCTGATGCCGGAACAATCGCTCGTCGTCCGAACGATTTTTCGGCCTCTTCAGTGAGATGAAG
TGTTGTGCGTGCTTTGGTGTCAGCTGACCAGTGCCGGAAGCGGTGGCTAAAGTGGGTCAACGCAAGTAAGGTCGCATTCATCTTCTTTGCCGCGTACCCG
GCCATAAGAGCTGTTGAGTGTCCGCGATCCACCGCCTACACGAAGGAACAAATGTAGCAGTAGACCCAGTTAAATAACTGCTTCCTTTTAAGGCTGAGCA
AACCATTTCTGCTAGTGTAGACAGGGAACCTACCTGTTTTACCATCCCATGACTTAGTGTTGCTTCATGGACCAAAACCTGCCAGGTAAGAACGAGTTAG
TGATTCCTCTACAAAAGTCCAACGCAACAGCAGCTTACATCGCAATTTTGTGCGATATCAAACATTCGCGATGAATCTGCAGAATCTCCCAGGATGGCCA
CTTTACGACCGCGAGCCTTCGGTCCGGTTACCTGTAGCACCATTGCGAAGAGGTCAGCTATCCTTCACGATACGATCCTTAATTGTGCAAGCGACCCACA
AACCTCAGATGCGTGGATGATTTCTCCATTAGGAAGCTCAACACTCCCCCCAAGCTTGAGTGTGCGATAGTTTGGCCCAGGCGGCAGCCCTCGCTCACGT
AGTGCATCCGTGTTCAATTTCCCAGGCACGTCATATTCCTCAACGACGTAACTGCAAAAGCGCCAGAACAACAAATTAAGCTCCAACAACAAGTGGAATG
AATAACCCAGGTCCACATACCCAAAACTCGTGACCGTGTGCTTCAACGTAGCAGCTTTCACAATAAACTTGCCATCATCCAATACATTCCACACGGCTCC
GTTGCCGTCTGACTCCGCCAACACCCACTTCAGTTTAAGACTCTATGGTACCAACAAAGCATTAACCCCATTAATCTCTGAACATTCCCTCCATCTCTAC
ACAAACTCACAGGATGCCTGGGTGCATTCCTCATGAACGTCTCGAACGCCGATGTCTTGCTCTGCAACTCAGGACTCACAAGTTCGTGCACTGTAACCTT
TAAATTCGTAAGCCGCGTGCTGCTCGTGGACAATGCCGTATTCAAGTATGAGAACAGCCCGAGCGGCCCGTACACCTCAATGAGCCTCGGCGTCTTCTGC
TTTGTCTGTGGGTCCTTGTATTCCGCATTATGGTTGTCTAGAGTGCACAGAATCCCAGGTAGGCCGTATAGGTGGTCTCCATGCAGATGCGAGATGAAGA
ACTTGGTCGTAAGAGGCACACGGACGACGCTCTTGATCAACTGGCGCAGACTTCCTTCCGCGCAGTCGAACATCCAGTTGCTACGGGCCAAACGCAGACA
CACGCCTGTGGGGTTACGTCGTACAGCCGGAGACCCTGCTCCTGTGCCCAGAAACAGTATCTCGAAGCCTGTAAACGGAAGCTGTGGAGAAGACACCAGC
AGCGTGTTGCAGCTGCGCATTGGCGCCGTCATGAGCCGCGCGCTGCGCTCGCTGATGCGCGCCGCCACCTTCGC