Description :
From Genome Similarity Track
Location :
Scaffold_361:3440- 9137
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_361-snap-gene-0.9Flagellar protein
Pytve_DAOMBR484maker-pve_contig_361-fgenesh-gene-0.650S ribosomal protein L13

Sequence
5697 bases(100 bases per row)
CGCAGCCATGGCGGACCTGCTGCTCTTCTGGCTCAACCACGAGCTGCAGCTCTCGACGGTCGTGACCAACATGGAGACGGACTTTGCCAGCGGCTACCTG
CTCGGCGAGGTGCTGCACCGGCTCAACCAGCAGCACAACCTGGAAGATTTCGTCAAGAGCGCGAGCGCGGACGCCAAGATCATCAACTTCTGTCTGCTGG
AGCCCACGCTCCGCAACATGAACATCAAGTTTGACGCCAACACGGCGTCGGCGATCATGAACGAGGCTCGCGGCGCCGCGGCCAACGTCCTGTATCAAAT
CAAGGTAAATGGATGAGCTCAGATGTTGGCATTAGATGTGATAGATGGATGGGCATTGTGACAGCGGATAACACTTTGTGCGTGGGGTTTTGCGCCAGTA
GATGGCTGCAAAGAGGATCCAACGCGCTCCCGTCGTCTCCACCAAGTCGTTCGAGCAAACCGGAGTCATCCCTCTGCACAACCGACCGGTGAAGCTACCC
AAGCCCGTCTTCGATGCGAGCAACCACCGCGCTTTCGAACACTCCATCCGACGGCAGGTGCACTCGAGTGGTGCTCTGCAGCGCCAAAAGTATGTGCATA
GTGGGTGGATGAGCTCGGGAGAAATCGAAATATCGACTGACAAACATGGACATGCTGATCCACATCCAGAGACGAGATTGTTGAAGAAGCCGAGATCCGC
AAAGCGTACCGAATATCGCAACAAGAAGAGAAGGATCTTCTGGAGCGCACCAAGGCAGAACGGCTGCACAAAGCGTTTCTGCACAGCCAGTTTATAAAAG
AGGCGCTGAACGAGACGGACTCTCCAGCGTGGAGACAAGCACTCGAAACCAAGAATGCGCGAGAACAGAGGCGAGCAGCCTTTTATCGACAACTTATGGC
GAAACACACCAAAGCAGAGGTTAAACTGGAGTCTGCTGTGATGGTTCTTGAAGTCTCTGAACGACTGACGGGTTTGTGTATCATCAGGAGGATCGGCTGT
TCAGTCTCCGACGGACCGTCCGCGACGACCTCGACGCCTTTGATGTACGTCGCGGCTTCATGAATCGCGGCTAATCTTTCACTAACTCGACTGTGATTGA
CAGCGCCAGGAAGCTGCGAAGGCGGGTGGCGGATCCAAGCCCTCTCTTTCCAAATCTGCAGGATACGGTCTGCGTTCTCTCGCAGTCACATTAGCCAAGT
CCAGCGACAACACTGACACTGCTGCTCCAACGGGTCGCTACGAGGATGCCTCTGCTGAGAATGCACGAGCTCAAGACTCGAAAGTAATCAAACAGCAGAA
ACTTCAGCGGGATCGACGAAAAGAAGCGCATGAACGAAGGCGCAAGCGGTTCCTCCAAAATTGTTCTCTGAGGCACACCAACTTGTCAGGCGTACGCGTG
ACGGCGATTCTCGAGACACTGACACTCCGCTCGACAAACAGTGAGAGGGAAGTCTGCGAAGAAATCGAACGCGTCGTATTGTACAAAGACATTGCCAGAG
AGAACAGGACGCTGCGATATCTTGCATACAACCGTCAGCGAGAGAACGATATGGCTGCGCGTATCGGATCCGACAGCAGCTTCTACCAGCTGCTTCTTCG
GCGTTATGAAGACGATGTGAACATTCAAGACGAAGAGCGTCAACGCTTGGAATGGGCTGTTGACGGCGCCGAGCATCACAACGCTGAGTCAATAGCCAAG
TGCATGATGAACGAAGTGCTCGACTTTGTTGTCTTCGCTGCAAGCAAGCGAGAGGACAGCCAGGCCTCTCGAGATTCGTCCGAGTTCCTGAATGGCGAAA
CGTGGGCAGAGTATTGCGAGCTGTTTGCTGCTGGGAAATCGCTCAACCTCGACATTCCTGCTACTGATGATGACCGCAGCTTGCAGCTGACGGAGCAGCA
TCAATTGCTGGATGCACGAGCATTTGACCGCTACTTGTCGGAGTTTCAACCTTCTCGCTTGCCTGGCGATTATGTTGGAGCAACAGCTAAAACGACCAGT
GTGTTACCCTGGCTTCCAAGTGACTCCAAGTTTGTTGGAGCAACTGACGTGCTAGAAGAATGCTTTGTGCTTGGAGAGGAGATCAAGTACTTGCGCTGGA
TCAATCATACCATCCTCCCAAGCGATGTTGTGGACAACGAGGATGGGATACAAACAGTCAGTGATGCTCTACTAGCGACCGTTGTGCAGAGTCCACTCGG
TGATTTTGCCAACGAGTTGCGTATTGTGTTCTTCGGTCCGCCGTTTGCCGGGAAAGAGACCCAAGCAGCACTGTTGGCGCAAAAGTTCAATTTGGCGCTG
CTCTGTGCGCATCGGCTTCTTGACGAAGCGGTTGCTAACAAAACTGAGCTCGGCGTGCAGATAGAGAAGGTTCTCGCTGAAGGCGACAAACTGCCATTTC
AATTATACGCACAACTCGCTGTCGAAGCAATTCAAGGTATCAATCGCGGCACAGATGATCAGGCAGCTTCTGACGGGTGCACCTCAAGCACCAACAAGAA
ATCGGGATGGATCTTGTATGGGTTGCCGAGTACAGAAGGACAGGCGATCGAGTTAGAGAAATTGCTGAGCGGATATGTGGATCCACGCGCAATTCCATCT
CCGTACGACTTCGAGTCGCCTGTAGCGCCTGGCTGTCCCAAGCCGGAGCTTCCTGACACTTTTTTTCATGGCAAATCTGGCGTCGATCTGGTGTTTTATC
TGCAGTGTGACGCTGCCTCTGCCACACAGCGATGTCTAGGACAAGTCGAGGATGGCGAAACTGGAGCGAAGTGGCACTTGCAGCACAATCCTCCCCCAGA
GGACTCAACCACTCGCCACCGCTTGCAGCATTCGAACCACAGCCAGAATGCGAGCGAGCTGCTCTCTATACAACTGCTGACACACTCAAAATGCGCGGAT
AACCAGAGATCGTGGCATTCAAAATTTGACACACTTCGAGAGGTTGACACAGTGACAACTCAGACCCCAGAAGGTGCACACGAAGCCATTGTCGAATATG
TCGAGGGGTTCGTCCGCATCCAGCAGCAAAAGAACTTGTCTTGTCAGCAAGATCAAGAGAGCACCGAGTTGAACAACATGGTTGAAGAAGAGGCGCGGCA
CGAGCGAATTCGCTCTCTTGATGCCGCGATCGTGAACGGACAAGAAGAGCTCGTCAGTCGGCAGCAGGCTTTGCAGCAAGCTGAAGAGGCGAAGGCCAAG
AAAGAGGAGCTGGTGGAGCTTCGAAACGCAGTCGACGCGGCTAAACAACACAGTGAGAAAGTCATGTTGAACGCCAACACATGGGTCGCAGAAGAGAAAG
CGATGCATGCTGAGGCTTTGAAAGTGTTTTCAGGGGATCTTCAACCAGAGCTGGCAAGATTGCTGGTCCAAACATGGAATGAGACGGAAGAGCAATACAT
CTCGGCGATGCATCGCTGTTTCAGGCACATGCGGCTTCAACGCTCAGCTCTGTCCGAGCACACTCAGTCGGTGGTGAACGAGTTTTGCGCATTTGTGCGC
CGTCCTGACCGGAAGCAGGCGGCGATCAATACCTTTCAGCAACAATTCAACGAAGTGATCGATGACATGCGCTTTGACGACTCGACAAAGGAGGAACTAC
ACGCGAGAACCGACATATTCCAAGACGACATGACCTCTCTGCTGTCCAACAAACGTGCCGAGAATGATGCCGAGCTGGTGAGCCTGCTGTCTGACGGGTG
GACAGAAGACGCCTGTCAGTCTATTGCGGCCACATATCAGCTAGCACTACAAGCCGAGTGCGATCGCTTCCGTGTATCCCTGCAACTGCTCGTCGATGGG
TATTCGGCATCTAGCAGGGATCGGTCGGATCTGTCGAGTTTTGTCGAGAATTTTCGAACGCAGCTTTACCGAGTGGACTTCTCGTGCCGGATATTCCGTG
ATCCATCGGGCCAGTTGGAAGAATCTCCACCACCAGTTGCAGCGGCACCGCCGGCTTCGACGAAACCACCTCCGAAAGGGAAAGGCAAGGCAGCTGCTGC
GCATGCCGCGCCTGCAGCTCTCGCTCCCGACCCAATAAATGACGGGAATGGTGACCCGATGTCGATCGAGGACATGCAAGCGATGTTTGATACAGCCGTT
CACAAGTGCGAAACTTTTATTGGCGCGGTGCTCACAACACCGGCGGGATCTGACAGTCAGGACGCCAATACCACCGATCTCGGACAGAACATTTGCGCTC
TGAACCTTCGCAATGGTATCAAGTTTGAGCACGAGCTCATGCAGCGGCGAGTCCGTTCCCTGCGCGAGGTTTCGCTGGCTGCGAGCGACCAACTCAAACG
CGCGATGAGGATGGTCGAGAACACTCTCCGCCAGGTTATTGATGATCGAAAGCGTCGTGAGGATGCTGCAGTAGCCTGCCTTATCCAGTACATCCGCGCT
ACAATCGAGAACGAGACCGGGTTGCCCTGCTGGTTCAACGTTGCTGTGAGTGTTTTGCCTCTGCTTCCATGATAGTGTTCCCCTTACTGACTGCCTCACT
GGAACTTGTGCATGTCCCATGCTGTATAGCCTCAGGAAGTGTACCGATTCCCCGTCACGGCGCACTTACTCGAAGATACACTCGTTGCAGTGGACGAAAG
CAAACGTCTGGTGCCGCTCGCTCCACCGGAAGAACCGCCAGTTGTCGAAGACACCAATGAACTGCAGCTCAGCACGCAACAGCGCGAACATCTGAAGGCC
ACAATAGGCATCGGACCGCGCTCGTTGGTGCCGGTGTTTGAGTTACTCGAGGCCATCGAGGCCGCCTCTAGTCTGCCAGATGCGATGCCCACGATCTGGC
GCGAGTGTTCGAATGTGGTGTTCGCACAGGTATGACCACTGATAGGCAAGATGGGAGATCGTGAGTGGTTGACTAACTGCATGTCGTTGCGAGAGCACAG
ATCGCGTCCAAGTTCATGCGCAGGCAACCAGGCTTCGTCGACCTTGACGCTTTCCTCGACTGGATGTGCCAGAACGAGGGCGAGTTGCGCCGCATAGTGG
ACGAGGACCAGCAGCCAGTCGACGTCCCAGTCGCTAGCACAGCGACTCGAACGGAAGAATCACCCGAGCACGCAGGAGCGATAGCTGACAAACCGCTAGA
AGCGGCATCGTCGTGAACCAAAGCTCTCGCCACACCAACAACCCACCACCAATTCAAAGCAAATACCTTTTGTCTATGGAACGTGTTCATCCTACCCTCG
GATACCTGCTTCGTCCTCCACTTCGCTCAGCACTCGCACCGCCTACAGAATGACAGGGTTCTCGCCGACCTCGGCGGCAAAGTCGTGCTTGTCGTCGAGG
AAGATCTTGAGCTTCTGGTCCTGCAGCTTGCGCATGCGGTTCTTGGGGAGCATGCCGTACACAGCCTTGCGCAGCACGTCCTCCGGCTTGCGCTCGAACA
GCTCCTTGGCCGTGCGCTGCTTGAGCCCGCCAGGGTAGCCAGTGTGCCAGCGGTACAGCTTGCCCTCCCACTTGTTGCCCGTCAGCACGATGTCCTTGGC
GTTGATGACCACGACGTAGTCGCCGCAGTCGACGTTCGGCGCGTACGTCGGCTTGTGCTTGCCGCGCAGGATGGGCGCGAGCTGCGACGCCAGGCGGCCG
AGCACCTGGCCCTTGGCGTCCACCACGTGCCACGCCACCTTGGTCGCGTGCGCGATCTTGCTGCTCATGCTGCTCCGCGTCCCGAAGGTCAGGCGCT