Description :
From Genome Similarity Track
Location :
scaffold_693:344- 2815
Transcript NameFunction/comments
Pl_102938peptidyl-tRNA hydrolase, putative
Pl_102939calcineurin-like phosphoesterase, putative

Sequence
2471 bases(100 bases per row)
ATGGAGGACGTGGCGTGGAAGTGCACAGCGGCGTTCTTGCTGGGCGCTGCGACGCACTACTTCGTGTCGTCACACTTACTGAGCGGCAATGCACCCACAG
CCAAGGAACCCAGCAGTAGCAATGACGACGCCGAGGAGCCTCGCTCTGGAGCTTCATCCCGATCCTCTTCAGGCTCCTCCGATGACTGGGAGGGCGAGGA
CTCGGCCAGTTGGGTGCCCCACAAAATGGTCCTGTGTGTGCGTACGGACCTGAAAATGGGCAAAGGTTTGTAGTCATTTGGCGCCATTTGGGTATAACTT
AATGCTAAGAGGTTAGTGTCCAGGCAAAATCGCGGCGCAGTGCTGTCACGCGACGCTAGGCGCGTACAAACGCGCACTTAAGCGGACGCCGGATGCCGTT
CGTGCGTGGGAGATGCTAGGGCAAGCTAAAGTCTGCCTCAAGGTGGACTCAGAGGACGAAATGCTCCTGTTGGCCGAGAAGGCAGCGGAACACGGACTTG
TGAACTACATCGTGGTACGTTGAGGTGTGAAGAGGGGAGGAGTGAGAAGTTGATGATGTTGTTTTACAGGTTGATGCAGGGCGGACGCAGATTGCACCGG
AGAGCAAGACGGTGCTGGGCATTGGTCCGGCACCACTGAAGGCAATTGACGAGATCACTGGCCACCTCAAACTCATGTGAGCGTGGAGTTGAGCTTGGAT
TAATCAAAGAAAAGATACTTGCATGGTTGTCATGAGGTGGATCAGTCTGTTACGTTGCTATTACCTCCCTGCTTTGATGGCAGATGAAGGTCATGAATTC
TGTTGTCTAAAGCGTAGCCACGGTATCGTATTGTGATCTGCTTTTGAGGATACCAGCGCGTCTGAGAATGAGGACGGTCAACGCAATGCACACCACTGCC
ACGATGGTTGCTAGAGCTGTTGCTCCAATCGTTTTCAATACGTCTTTCATGGCTGATGCGTTGTCCGAGGTGCTGGAACTGGATGAAGTCACAGCTATCA
TGCCATCAGCCGACGGTGAAGTGTAGTCGTTGTCGTGACCAGCAACTATTGTAAGAGCAGTGTCAACGCAGGCCAGGTATTCACCCTTCGTTGTCCACCA
CTTCAGCGTGCACAGCGTCTTGGCATGACAGATTGCGTCCTTGCAGGGTCGAGCATTGGGAGAACGAGCCTTCATGTTCAGGTAGTAATCTTCCACCAAA
CTCATGTTTTGCTCAGCACGCTCCACAAAAGCTGATAGCTCGGTAAGCGATAGCGATTTGAGGCCATACGCCTCGCTTGCCTTGAACAGGAGCTTCCAGT
CGAGCTGAGGCTCACTGTCCGCGATGTAGGAAGCGTACACAGCATAGTCTAGCACCTCGTACGTCTCGGTATCGTAGTCCCAGACCATGAAGGAAGGGTT
GTTGCCGAATAGCGGTGAGATCGAGCCCGTAATATACATGGGCAGAAGTTGGAAGGCATCATCATCCCCCGCAGTTCCATCAAGCGTTGTCACGGGTACG
CGGAACTCGACACTGTGCACGTGACCGAAAAACTGCGCCTTGATCACATCGGCATACTTGCCAACGATGTTCTTGTACTTGACGATGTACTTTGTGTGCC
ACTGAGGGTTGCCTCCATACGAGTCCACAATCGGAGCAATATGACCAGCAATGTACGCGAACTTTCCTGCCTCCTGAAGCTCAGCAAGAGTCTTGTCCAA
CCACGCAAACTGCCCGAATGGATCCAGGTGCTCGGACGTGTCCGGCAAGTGACTTGGCTGCAAGTTAGCATAGAAAAAATCGTCAACTCCACCTATCTCT
ATGCAATATTTGCACATCAAACCTACCGAATACGACACCGTGTTCAGCGTGATCACGTGCAGCTTGTCGTCCAGTGCATAACTCAAATACCCACGTCGAT
TTAACAGATCCATACTCGCAGCTGACAGTGAATCCTCCCACACCTCCGAGATGAGCTCAATGGACGGGTTCGTCTCTTTCTCTGGGTCCGTCACCTCCAT
GTGATAGTCCGGGTCTACCATCATTAAACCATTAGTCCCTCTCTCACGAAATATCAACAATTATCTCCTTACTCCCGTCTGCATTGCCAATAATGGCCGT
CGCTTCCAGCATCCCGCTTTGACTCTTTGGTGGATAATAATTCTCCATCGCGTGGACATTTGTCTCCACAGCTTTTGCAATGTATTTATCAGTGAACAGT
CCATGGGCTGCGTGATCTCCCGTGTACAGGAAAAGCTCGGGGTTGGCCACCACGTGCTCCTTCGCGTACTCCAGCGCTGATTCAAGCAACTGTATGGGGG
CATCAGCAAAATAGTGGATGGGAATGCGGGCGTTGTCTGCAGTTGTGAACGACTCGGAGATGTTCAAGTGCACGTCTGAGAAGTGTAGGACGTGGCCCAC
AGACACCACAGACGTCGGGGCAGACAACAACGCGAGCAGCACCAACCCCAACATTGCGAATGGTTTTATGA