Description :
From Genome Similarity Track
Location :
Scaffold_2165:344- 2717
Sequence
2373 bases(100 bases per row)
TTCGAAGCTGCGATGAGTCGGTTTCTGGCCGAACAGGGTATGAGGGCGTCCGTGCCACAAGCGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGA
TGGAGTCCGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCGCAGCCGGGGC
GGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGACCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGG
ATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATTAGGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTACCGGGGCCAGCCAGGAACTGGT
ATCGGCAGCTGGGCAGATCCACCAGGAACAGGTGGCCGGATTTGCTGCGCAGCTTCCAGACCCAGTTATGTGAGATTGAGAGTGTCGGTGGCACGACAAT
ACTACCATGCTCGCCGCAGATCGGATGAATCCCCACTAGAATACCTGCATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGG
ATCCAAGGTACTGCGGGAACACGTGGATCACTTCATCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGTTACGTCTTCCAGACGCAGAT
GTGCTCGCGGGCTGTGGATCGCGCGAAACACCGCCATAAGAAGGCGGTGGTCGGATCCGGCAAGTATCGCCAAAGGGCTCCGACGCCCACGGCCCCAGCT
CGACGTGTCCACCTAGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACGGTTCGGACTCCGACCCAGAGGATTACCGTCGAGTCTGTCTCACTG
CATCCAACGATCGAACGGCGAAGACCGAAGACAACTCGCGGTCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGG
GACAGCACAAGTCGGGTGCTCGCAGTGCGGATCCCGGAAGCACACAGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCAT
CCCGGAGATCATTGCTTCTACGTGTGTCGCGGGTGTGACGAGATTCACGACGTCGGCAAGTGTCCGATGGAGGAATTCTACAACCAGATCCGCCAGTGGT
TTGATCCAGCCAAGCACAGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTAAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCT
AGGTATTGCATTTATGCATTTGTGAACAAGACATTGCTAGATCCAGGTTGCAGGACCCTCGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAG
TTGCCAAGATCTCTAGTTTGCGCTAAGTGGATGAGTTTTCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGGGGAGAGGCACGTGGTTACTGGGA
GAAGCGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCGGATCCCCCTAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGACGAG
GTGGGATCCATGGATCTACTAACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAAGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCTAGATCA
ACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCA
GATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACAAACGGGAGAACGCGAATCAAGGTCACGTTGGCAGGTTGTTTGGTGTACTGGTTCGAT
ATTTGGGTTGGAGATCTTGCTGGTCAAGACGCCATCCTCGGAATGGATTTCATGGTACCAGCCGGAGTGAGGTTGGATCTGGCGGATGGGGCACTTTGTT
TCCCTGACGAGATGCGGATCCAGCGCAGCGGACGGCGACCGTTGTATGGGGCGAAGATGAGAATCATAAGGGCGGATAAGACCACCTGGATCGAGCCCGG
GGAAACTTGGGAGCTGTCAGACCGGTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGCCTACAGTAATCCAAGGACCA
GGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGGCGATGGCTGGCGAAGGACGGTATCC
CTGGGCGACCTGGATATGTGTCAGTGGGATCCCGTCGTTACCGAGAATGGCAGAATCTGGCGTATGAGGCGAC